Description :
From Genome Similarity Track
Location :
Scaffold_4358:687- 1767
Sequence
1080 bases(100 bases per row)
CGCCACCTATCCGCATCGCCGTCGTGGGCGGCGGGCCCGCCGGGCTCACCTTTGCCAGCCTATTGCACCGCAAGGCCACGGAACAGAAACAGCTCAAGGA
AGCTGGCTGTGTGCCGTGGGAGGTCACGCTGTACGAGGGAGAACGCAGTGCCACCGCTCGCCGCGTTGGTGGACAGTTGAACCTCGACCGCAAGACTGGC
TTCCGAGCCATGGAGGCCGCCGGTCTCTTTGACCGCTTCCACGAGTTTGCACGTCCTGAAGGCCAAGAGCTTTGGATCCTGAACCACCACGGTGAAGTCG
TGCTCCACCATGCAGGAGACGCGACTCCGGACGACGACCGCTACAGTCCCGAGATTGACCGCGCCGATCTCAACCGCATTTTGCTCGAAACGCTTCCGCC
GGACATGATCCGGTGGAACCACAAGCTTTTGGCTGTCCATACCAAAGGCAGTGTCTACGAATTGGAATTTGCCAGTGGCGAAAGGGTCGAAGCGGACGTG
GTGGTCGGTGCTGACGGTGCGTGGTCCCGTGTGCGGTCGCTTGTGACGGATCAACAGCCCAAGTATCCGGATGCTGACGCGACGCTACTGGATATCAGGA
TCCACGACTTTAGTGCCCGCTATCCTGAGCTTGTGGAGACCGTGGGCAAGGGCTCACTCTACAGTTTCGGTGGGGGGAATATGGTGATCGCGCAGCGCTG
CAGCAGGGATGTGGTCCATGTGATGTTGGGAGTGCGAATGCCGGCCGACTGGCGCCAACACGAGTTGCTCGTGAAGCACACGGATGCCAGTGACCGCGAG
CGCGTATCGATCCTTGCCAAGGCATTTTTCGGGGACTGGGGCGAGCCGCTGCGGTCGCTCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCAA
GGCGAATGGTAATGGCGAGTCGACGCTGCGTGCGTGGCCACTGTATGCGCTCCCCGTCGGCATCAGCTGGCCGCCGCGTCGTGGCGTCACGCTGCTCGGC
GACGCGGCGCATCTCATGTCGCCATGCGCCGGGGAAGGTGTCAACATGGCCATGGTCGACGCCATGGCACTCGCCGAGGC