Description :
From Genome Similarity Track
Location :
Scaffold_1464:6869- 8520
Transcript NameFunction/comments
Phypl_g13475hypothetical protein

Sequence
1651 bases(100 bases per row)
CGGAATCCATGGCTTCTGTGGTGCAGCCTTCGCTTCGATTCAGATGAAGAAACTTCACCACCTCTAATTGGCCTCGAGAAGCGGCCATATCCAAAGTAGC
AGCTGTGCATCCTTCGCTTCGGTTCTCGTGAAGATATTTTACGATTTCTAGGAAACCACCCACCGCGGCGCGGTGCATAGCAGCATCTGTGCAGCCCTCT
CTTCGGTTTTCATGTAGAAATTTCACGATAGCGAGGTGcccgtctgcagcagctcggtccATGGCTGCAACCGAGCAGCCTTCTCGTCTATTCTCGTGAA
GCCATTGTACCATCTCGAGATTGCCTCTAGCAGCAGAAGTATCCATTGCTGTAGTCGTGCAGCCTTCGCTTCGATTCGCGCTCAACCACGCGACCACATC
CAAATGGCCATTATCCGCAGCACCATTCATTGCGTCCAAAGTACACCCTTCACTGCGGTGCTCATGAAGCCACTCAACGATTTCCAGGAAGCCAAAATTC
GCTGCCGAGGCCATGGCGTAAGTAGTGCAGCCCTCCAAACGGTTCTCATGTAGCCACTTCACCACATCCAAGTACCCGTTACGAGCCGCTCGATTCATCG
CCGCTTTCGAACAACCTTCACTGCGATTCGAGTGTAACCACTGCACCACTTCCAGGAAACCTTTCCCCGCAGCGCCATCCATCGCTGCCGTAGTGCATCC
TTGACATCCATTTTCATGAAGCCATTTCAGCATCACCAAGTCTCCGTTCAGCGCAGCCTTCTCAAATGCAGCCCCCATGTGCCGTTCCCCCATTTCATCA
TGCAACCATTGCACAATCTCCAGCTGACCGTGTTCCGCTGCAACTCCGACCGTCCTGTCCCCAGGCCTGGCCAAGTTCTGCTCCACCGCCCACTTCAGAA
ACCACAAGCAtccatctcctgcagctcggtcGAAATTCACAGATCGATCTCTCAGCTCGCAATTCTCGAGCACCCACTGCACCAACTTCCAATGGCATTT
ATCCTGCGCCGTCCTCTTtgcttcatcagcttcatcAGCTCCAACTCGACACAACATGTGTATCcactccaccagctcctggtccCCTTGTGCAGCGGCC
ACCAGAATCAACTTGGCTGCACACTCCCTATGAGGCTCGGCGTTTGACTTCAGCCActcgacaacttcaacgtcctGTTTCAAGATGGCCCCGCCCATCT
CCATGCCGCCCCAATAGCCCAGATTCCGGTGGTCggaatgtagccatttcagAATGCTCAAGTGtcctccagcggcagctgccgTCACTGTCTTGGTGAG
GAACCGGTCAGGACAATAGTATTCCaccagccactgcagcgtcaTCAGGTCGCCTTGTGCAGCtgcggacgccgccgcgtcgtTGAGGATCGACCATCTG
TAGCTTGGATCGAGTCTCGCAGGTTCGCGAGCGCTCAGAAACTGCAACAGCCGGAGACTCGGCCAGTGCGCGTAGCCCGTGGCGACTGTCCACTTGAGCG
AGACGGTATCCAGATACTCGTCAATATTGTGAGTCACGTGCGGGAGATCGCCGCCTCGCGACGCCAAACACTCGCGACAGACCACGGATACGGCCGTGAA
CAGCGGGAAGGCCATCTCCAAAATTGACAGAGTGGGGAAAAGGCACTTTGG