Description :
From Genome Similarity Track
Location :
scaffold_681:6869- 8292
Transcript NameFunction/comments
Pl_103003hypothetical protein PHYSODRAFT_511833

Sequence
1423 bases(100 bases per row)
GAAGAGTGGAATGCCAAGTACGAACAGCAAGCTGGTCTAGAGGATGTGGTAAAGTATCAAAAGAAGCTGCGAGCACAATTGGAACAGCAGCAGCAAGCAA
ATATCAAGCTGCGGCAACAACTCAACGAACAAGTGGGGGCCACTGGAAAGCTGCACGTGGCGTTCGAGCGTTTGAAAGTTGAAAGTGGTAAACCTGCAAG
TTTCGAGTATGATGATCTCGATATTGCCGATCACTTGAAGGGTCAGTTAGCTATCAATGAGGCGGTGGTGAAGCAAATGGAAATCCAAATTCATGAGCTA
GAAGCTGAGCGAATGCGATTATTGCAGAAGCTAAGAGATCAAGCACGCCTTACTGGTCAAAAGCTTTATGAGCAGCATGGTCTTACCATTGAACGGTGGG
GGGCCGTAGAAGAGTTCATTGATCGTGTAAAACAAACTCCCGAAGTAGCTACGCGGCTACTTCAGACCAAGAGTGAATTCGTGGACGTACATGACAAAGA
TCAATCTGAACAACGAGCACAGGTGCAACAGGATGCTATAGAGGAACTTGAGAGGAAACTCGACATTAGGTGTGAGGAAAACATGCTACTTCTAAAAGAA
ATTGAGAGATTGCAGAGCGAGCTAGAGGTGGCACAGTCTAAACCTCTTGCTCCGGTAATGACAGAACAAGTTTCGGGCCCAGATGATGGCAGAAGTGAAC
TTTTACGCGCGCTAGAATTGGCCAAAGCAAAGTCACAACGGCAAGAAGGTGTCATTTATCATCTGCGAGCTGAGATTGCGTCTTTGCGAAAGGATCGCGA
ACAAAAAGGTAGCAAGAAGGAAGTGGCCCAGTCAAATATTCCGCCAGAAAGTTTCGGTCATATTCAGAATGTAGCTCAAGAGAAGGCAATGGGCGAGTTT
CATATTCAGGCCAACGTAGAAACACAAACATCACCGCACCCAAAGACATCGAAGCCGAAGGTTGAAACATGCTGTGACGATGATGCAGGAGATTGTGACG
TGTTGCTGTCAGGTGAAGAAGAAGCGGAAGAGGAAAAGATGCCTACAAGCGTTAAAAAGTACAAGAGAACTACCGTGAAACAGACCAAACAACAAATGGA
AGAGCAATCGAGTAAAGTACAAGAGAACTACCGTGAAACATACCAAACAACAAATGGAAGAGCAATCGATAGCAGAACAATCTCATCCTCACACACATCC
AGACAGCAAGTCTGGGGACGGCTGGAGCGATCATGCTGATAGCATTGCACAGATAGTGGCAAAAGCAATTGAAGCTCAATTTGCAATACTTCAATCCCAG
ACGGCTTTGTTACCATCAGCACTGCCAACCGAAACTCGCAATCCTGCTACTCCAAAGATGGCACGGACTCACAAAGACGCTGATGTACATCCAGTTACAT
CATCGAGCCCTACGTCTCCAAAA