Description :
From Genome Similarity Track
Location :
Scaffold_28:68688- 70286
Transcript NameFunction/comments
g8821.t1hypothetical protein
g8822.t1hypothetical protein

Sequence
1598 bases(100 bases per row)
CAATGTTAGTGGATCACGCGTGAAAGCTGCATGTAACATAGGGCCGATATGGCATTCTTACCTCTCCGTGTGACGTTGAAAGCTCCGAGTCCTTCGGCAT
GCTCAATCCACGAGGCGGGCGGAACTTTCGACCAGTAGACCGGCCCACAAAGCAGGATGAATGTCGTTTCTGCATAAATTCAAGGCCGCTGTTAGCCCTC
TAGAACATAATAAGCACTAGGAAAGATTGGCGTACCACGTCAATGTCCATGGAGAATTTCCGCCCTCGATAGGGACCAGTGATGCACTGCACCGCGATTG
TAAATGCCCGTGGAATAGCATTGCCGTCTGTTACAGAACACGCAACACCACGAGACTTAGTCGCAACTAGCATTCACTACTTTCCAACAACAAAAAACGT
CCGCACCTTTGTCGAGATTCTCCTTCTCAGCCTCGAGAGCATCCAGCAGTGCTTTCTTGCCTGCCTCCAGTTCTCGCCGCAGCTCTTCCGCCCGCATATT
CGCTTGCTCCACCAGTCTCTGCAGTAACCAATCCTCACAATGGTCAACGATGCCAGTCAACCACAGGCTCCGCGTCAGCGAACGTACTTTGGACGACGCA
TGACAGTCCCGCAGTAGAAATCCCTGTACGTCGATCATATCATCCATCTGCTGCTGTGTGACATCATTGTTGTCCTCTTCAAGCGAACTGGAAGCCCTCC
CTAGAGCCACAACACAATGAGCCATTTCAAAAACTTAAAGTGCAAACTTTTCGTCGGGTGTTAAGCGTCGACACGCTGCAATTCGGTCAACCCGACTGTG
AAATAGTTGAGCAGGTTATTGTACCTCTCTTCATGGAGGGTGCGGCCTCCTGTTCCTCAGTTGCTGCTGCAGCGGCTACGGTGATCGCATGCTTCCGCTT
CATCTTGGACGAAGTCAAACTGGAATTTGAAAAAAGTGCGGCAGCGAATCCAACCTGAATATTGTCCAATGGAGTGGCTGATCGATTTTCGACGAATCAT
GGTCATTTTGAATTGGCAGTTAGGAACAGTTATAACAGTCGGAATGTCGGACGCCCGCCAGAAGAGTGTCGTGGTGAGCAAGCCCATTCTCTATGGGTCG
GTGGCCACGTACCTCGGGCGCAAGGCTGAGGAGACCAAGACGCACCGCTGGTCCATTTACCTGCGCGGCGTGGACAACGAGGACCTGTCCTACATGATCA
GCAAGGTCGTCATCAGCCTCCACGTGAGCTTCGCTAATCCGGTCCGAGGTGCGTTGTATTTAAAATGTATTTATCTTTAACCGATAGTAACGGATCGTGC
TTAACCGCAGTTCTGACGGAACCACCGTACGAGGTTACGGAATTGGGCTGGGGCGAGTTCGAGACGCGCATTCAGATCTACTTCCACGACCCAAACGAGC
GGCCGATCAGCATCATCCACTTGCTGGTGCTGTATCCACCCAACAGCCAGCCTGCCAGCACCAAGAAGGTAACTTCAGCTTGCTTCAAGTCTGCACAGCA
CGTTTTAACGAACACTCCCTTTTGTTGTTGAAGCCCGTGGTGAGCGAGTTTTACGATGAGCTCGTGTTCAATGAGCCGACCGAGTTCTTCTACAAGAA