Description :
From Genome Similarity Track
Location :
Scaffold_505:6867- 9345
Sequence
2478 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATCCCAACCAAGATACATGGGAGCCGCGGAACGTCTTGCTCGAAGACGTCCCGGACAT
GGTGAGGGCGTACGAAGCCCACCATGCGCTACACGCTGGAAAGTAATACGAGCGCTGTTGTTAACAACAGCGCCCGAAGGCACTTCAAGGGCAGGCTGTG
GGTCCTGCCCCCGTGGCAGCGACGCGCTTCGCACGTTGCCGCGCATTATACCCAGCAGCAGAGATGTCCTCCGCTGCTGCGCCAGGGGTCTTCAACTTCG
ACGTGCTCGTTACGGAACGAGCACGCTCTCTTCAAACGTCACGCATTGACCAAACGGTCAATGGTGGTTAGACGTGCCGAGACCGGCACGTCTAACCTTG
AGGGGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGACTACAGTCACTTGTATCTCTGACAGACACGGCGTCTGTTCGAGGTTTGAACACTTCCTCG
ACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAATGCAGCATCTT
TTAGCCAATGAGTGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAAGTCAGAAACATAA
AACAAAAATAGCAGTTCTCATCTTTTACCAAAACACACTACTTGGACTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACTTAACTCAAGT
AAAAGAAACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCACTACAGTTACTACCACGAGTAGAACCACA
CCACTTTAGGATAACCAATACAATGGAATATACAAACACACAGCCGCCACTTATTCTTAGACCCTTGGGCGGTGGGTCGTACACCAGTCAACTAATCTGC
GATCAAGGTACTGGTCAACCTTGAACGCACTTTCACACGCGCACCACCCTCAGATGAGGGAAATATACAGACCAAATACAATCCGATCCTAAACGCAGTC
AGTCAAACTATTCTCGGGGGCGACTGCTACCAAACCACCCGAGATATCAATCGTTAACATGAAATGGGACACACCCTTACCTCAACGCAATGGGCCCAAC
TGGGAAATGGAATACGTGGATCACTTCAACAGCCGGAGCAGACTGATCCCCACGTAACTGGACTTGAATGTGTGTGGGGAGCTCCGCACTGCCCTTGTCC
TTAAAGACAGCGGACCCGATTCCTCGGCGACTTGCGCAGTAGGGGGTAAAACGAACTCTCTGATTGTTATCTGCTAGACTATCGCTAGGCTTTGTGTAAA
GGTATCTCTCTCGTAGCGCTCTTCTATTTTCTTCTGTGTTCTTCGCCACGCGTCTGGCGAATATCTTGACTTGAGTATACTGGAACTGTTGACGTAGACA
CTTCCCATTGGATTCTTGCCCAGCTTCAATGTGCCCGTGTCTTTGTGCATGACTGGCTCTTGAGAAACATTGGCCGCATGTGGCCAAGGTTCCCTTGAAC
CCGCATTCCTTGAAACCGGGTTTCAGAGTCAGCAGGCCTGAACGCAGTGCGTCCAAGGTCTGCAGCCAAAGGCGATTTGCGCCCAAGGCTGAAACCATAC
TCAAGGCCTTGCGCCAAGGGTAGGTTGACTCTTCGCTGGGTCTTGGGGCACTTGGCGGGACTTCGTCCGGGTGGCCAGCGGTCTGGACACCATGTACGCG
ACTTCACTGGGGTGGCTGAGCTCCGGGTACACGAATTCGATGTGGGTTCAGAGCCTAGGCGAGACACCGTACACGATACGTTCGTGCAGGTGTTTTCGAC
GGCCTCAATGTGTCAACCCGCTTAAGGACGGGGGCGGCCTGGACGGATCGAGTGCGTTCAGGGTTTCTTGTCTGAACGCAGTCTTCCAGGCCTGAAGGGC
CCATCCTAGGCTTGAGCGCACTTCGCTCCGCGGAACACAGCCGAATTCCAGCTCAGGTGTGTCGCACGGTGACAACCG