Description :
From Genome Similarity Track
Location :
scaffold_9:686365- 688156
Sequence
1791 bases(100 bases per row)
CTTCCGCCAGATCGTGGTATACGACACGAGATCGATATTGAGCCAGGTGCAGGATTTGTGCTATTGCGTCAATGGTTATTGCCAACTGAGCAATCTGGAG
TTGATAGACTCCTTCCTGCGCACTAAACAGCTACAGGGGTGGTTGAGAAAGAGAGTAAATCTCTTCACAGTGAGCCAGAGCTTTCCACTCGCAAAACCAA
TCGCAAGTGCCGCATTGAACACGCATACAACAAGTTAAACGCCAAATTGTGCCAGCACAGACCCCTATCCTCGCAGAGATGCCATTATCAACAAGATTAC
TGACTCAAAACGCTTCAGTGTACTTGATCTTTTATGGCAACAATCAAGTTTTAATGAATTCTCCATCAATCCCGTGTACAGCAGTGAGCACATCTAGCGA
TAGTGGCTTTTGATGCCACAAGTCTAATTCGCGAGCGTAGTTTAACCATCTCGTTACGCATTTATTCTGTCCATTGCGATCGCATCGATGGAGTTTATTT
TGAAGACCTGGAATTGTATTGGCGTGTATGACTGAACATCAGCTATTTGCCAGCATTGAATAATGTATATTCGGCGCAGAAGAAGTACCAGTTTTGGGAT
GTTCTGTCAGCGTAGACTGTGTTCCGTCAGACCAAGCAAAGATCAAAGCGATCACAAAGTGGCCGACGTCAACTAACCAAAAGGACCTAAGAAAATGGTT
GGATTTGACCAACTATCTCCATAACTATGTTAATATGACCCGCCCATTATCCGACTTGTTAAAGACAGGTCAAGACTGATAATAGACAAATATTTTATGT
AGCCACCTTCGACGACTTCAAGTACAGCTTGCAAGCAGCACCTAATTTGGCATCACCAAATGACAATTTACCGTACAGTGTGGCGTGACGCCTCCAATTT
TTCGATCATATGTGATTTGCTGTACCAAGATGTCAGTGGACAGGACCGTGCCATCTCGTGTTAGTTGAGGCAGCTGAAATGAATAACCCCGATTATGACA
ATATCTAGAGTTCTCCTCTTGGGCCCCAAGCCATTCGTCTTCATACCGACCACGAATCGCTGCGTACAGCAACGTAAGCGTCACAATTTTCACAACGGAT
GACTCGTTGGTTgtttttctttgcagaaCACGTGGCTTAGAAGCCAGGCAAATTGAACATCTTGGTAGATGTCTATTCGGCGTCCCGATTATGAATTATT
CGTGATTTTCCAAGCTACTTCCAGCCAAACGACCCAACTTGTGCAGTTATTCTTAAGTGGTTGACAAGTACGGATATTTCAGTCTTCTCGACATTATTCC
GGCGAGCTCGTGGTCGACCTTATCGATACTCCCTCCAGGACGGGTTATTGTACTACCAATTTTACGAAGGAGATGACTCTCGGGTTTCGTACCCGACAAC
AAAGACTTGAAGCAAAATATTGAGAGCACACGATTCGCCTATCGCAAGTCCACTTTTGTCGGCCCAAAATGTATGCTTGGGTTGACAAGTACCTTAGAAC
GAGTGAAGTTTGTCATCGTGTGAAGCCCTTCTCACACAGGCAGGCTCCATTGCTGAGTCTGCAGTACCAGCAGATTGCCGATAGTCTGTCATTTTGAACT
ATTCTTTGGGTGACTCCCTGATTCCGCAGGGCATAATGGTGTTTTGGTCTTTGTAGGCCGTTTTAACAAGATGGTGCACCTCGCGCCAACGGTTTGTGCC
GTTGCTGGAAAACAGAGCGCTTAATTATCGACGATCATGTCTTTCGGCATCATGGACTACCAGAGTCAATCGTATCCGACCGTGATACacg