Description :
From Genome Similarity Track
Location :
Scaffold_882:6863- 12351
Transcript NameFunction/comments
Phyta_totarag11173hypothetical protein
Phyta_totarag11174phosphatidyl inositol kinase (PIK-A)

Sequence
5488 bases(100 bases per row)
GCTCAGAGCGTGACAAACTACCACAAGAAATGGGGTAAGTGGATTACTGGTAAAAACATAATCGAGAAGGTTGGCTGtttgcagctggaagagcttgTCA
TGGCGGATCCACGAAACGAGGACGATTTACTCCGGCTTGGTCTTCGTTACGCTCGGTGGCCAGGAACAAGCATGGCGGCGATTTTACTCCTGGAACATGC
AGCGCTATTGCATAAGAACGCAGCAGGGTCGCGAGATTACTGGTTTTGGCTTGGGTCAGCACACTTGGATATCTTCATGCGTCACCGTAAGTATCTACCC
ATTGCGCGATTTCATCTGAGCAAGAGTCTTCGAGCATTTACGAGTGCTTTCGCGTACTTGGAGAGCTTAGTGGACCCGATGCTGCTTCTCCGTTATGCAA
TTGGCCTTTTCTGGCACAAAGGCGACGGGAACTTGGAGAAGACACGTGATATTTTCCAAGAGTTGTTCTCGCAGTTTGTGAGCTTCTGCGATAAGGACCG
ACCGAACTTGTTGTTTCTCCAGTTTCAAGTACTTCATCGCCTGAAGCTCTACGTGGACGCGATCGACTGTATGAACAAGATCATCACTCTCCATGACAGT
CTTCCGCATCAGGCAACACCGACGGGTGTTCCAATTCTGTCTTCAGCAAGCACAATGCCACACTTTGCAGTCTACGATGCTGCAGATTATCGGCTTATGT
TGATGCAGTGTCAACAGACCAGCGGAAATTATGTGTCTGCAGCTCAAAGCCTTGCTTGGGTTTTGAAGCTCAAGGGTGTGCAGCAAGATGCCGCGCTCAA
GGATGAAGAGTACTTCGATCTGTGGTTCTCTCTGGCCGAGAAATGTTTTCATCACGAAGACTATGTGCTCGCGTTGGAGTATTATGCGATTGCGCTGAAT
TTCGCAAAACAATCTCAAGTGCTCGCCGCCATCCACAACAACCTCGGGCTTTGCTTCCACTCTTTGGGTGAAGACAACAAATGCGTAACGGAGTACAAAC
GCGCACGCACCGCGAATCGCCACGTGCCTCCCTTGGCTTCACTCACTGAGATCAGTACCCCTTATGACGAGCGCTTTGCACAGCTCCTTCAGAAGTCTGT
TGTCCAGACGATCGAAGAAGTGCGTGTGGAGTTGTATGGCAGAGCCGTCCGACGTCTACAGCGTGTTTTCCGGAAGAGCCGAAAAAACCTGAATATCAAC
CTCGATAGCAACAGCTCGGACAGTCCACTAACGAAGATGCCCAGTTTGTCCAAGCGGAGGTTAAgcatcgcagcagctcgaaacCCCCCTGCTCTTGTTA
AAATTGAAGCCAGCACCGAAGTAGCAAAGGccaatgaagaagaaagcctGCCGCAAAAAATTGTGGCCGTTGATGATAACCAAGCCAGCAGGTATGAAGA
TAGCACccttgaagtcgtcgagcgCCGTCACGAGTCTTTTCTTGCGAGGAAGCAGGCGGCAATGGACGAGATAGCTGAGCTGCTCACGAACCCACAGTAT
CGAGGCCGAGAATCATCGCCGTTATCTCGTTCAAATGCACGGCCCAAGGCTGCTACACAACTGCGCAGTGGACTTCTGTCACCCGAGAAAGATCGCCTGG
ACGCACGTCGGACGCAGTCCATGGAGACATTTCATCAGGTATGCCACTCTGTTATTGTCTGGTGGTTAGTTCCTGTAAGTTTTGAGCTTTACTCACGCTT
TATCAACTGTATCTGTTTGTTGTTCGCACAGCTTGGCTACATCTCCTCAACGATGCCATGGATTGAGTTTTGGGAGAAGCTGCTAGTTCTTGCACCAGAC
CTTTTCGAGTCACGGCAGGCTTTGTACGGAAGCATTGCACGAATTCGAGGCCGACTACCATTAGTGACTGATGAAGTCGCCTTCTGTGCCCTGGCTGAAA
GCATCGGAAATGTCTACGAAGCAGCCGAAAAACTGCATGATACGTCCCACGAGCGAGAGCTCACTTACGTGTGCGCCGTCATCGAGGTGTCGAAGCAACT
CGAACGAGATTTTCCACTGGGGCCCGCGCAACTGTCCATCAAACCTCCTCACGTCTCCCTCCCTACCATTTCGTCGCCCAGGGCTACTCATGGATCGCAT
AGTCCTGTTGGGGCACTGACATCACGCCACGTTGTGTTGCCTCCGTATTCCCCGACCCATGCGACGATTGCGTCTATCTCCAAGCCGAAAAAGCACCTTC
GGATGAACCAAATGCTCAACTTGCACTTCCAGGAGCACGTCCAAAAGCAGGAAGCAGCAATCGCAATAGCCGAGGCAACGGGAGGCTTTGTGCAGCCCCA
GCTACGAACGGAGAAACTGATGGTACTTCAAAATTTCCGGCAGGCCAACGCTGTTCTCCTGAGTTCGCAACTGGCATTCGGTAGCGAGAAAGCGGCCACA
TAAGGAAGTATTTTAATTATCAATTGTCTTCGGTAAACGGGGATTTGTCAGACTAAACGGAGAAACAACATTAGTGTAGATGGGAGAATGCACCGACGCA
ACCACGCCTACTTAAGCTTCGTTGCAACCTTGTGGATCCAGTCCACAAGCAGCGGGAAGAGAGCGGATACACTGTCATTGATGAGCCCCAGGAAAAACTG
TTCTGCTTGCTCGTCGGTCAAATCTAAACGGAacttctcctccaccttcagcagAGTTGTAGCAGGATTTGCCGACAACTCTTCAATCCCAGAGTCGGCC
ATCAGGCTGAGCAAGTTCAGAATCAGATCAGCACTCTTACGCAGCCAATTGTACGCTTGGCAGCAGTAGGTCGTAAACTTTTGGTAGTGCTCGCTAGTGG
GGCCACCCATGCCTTCCACCATTTCCTTTGTCAGCTTGAACGGAGGTGGGTACGGCTTGGGATCAGCTCCGAAGACAAAGCCGAAATCAATGTGGAACAA
ATGACCTTCTGCCTTCATCATCAAGTTGTCCAAGTGACGGTCACCGATTCCGAGCAGATACGTCAGTACACAATACCCGGCCACTGATTTCACGTATGTG
CTTAGAGCCTCAGGAGCGATTCCATACTCCGCACCATCCTGCGGGTTATGCTTCCGCAAGAAGCCCACGATCTGCGGCGACTCGAAGTGGGAGACCACAT
ACGATACCGGGTACGAATCTTGAACAAATTCCATCAAACCATCGTTGGCGCCCGTGGCCAAAATGCGATACGGAGTCAGCTTCAAATCCAAGTTCACCTT
TTTCAGCAGCCGGTCCATCAGAATGAACATTTGCATGATCAGTTGATCTTGGCGAAGATCGTCTCCGTTCTTCACCATGAACTTGTACATCGGCCCTTCT
TTTAAGCGGTGCGAGCGGCCACCACCCATTATACGGGTCGGCAACGATTCACGCATAATGCTGGCATCGCTTCCGCCAAACATCGACTGACTCAGGTTTG
GCGGATGAtgaccttcaccttcagtGATCGTGTGGTGCTGTTGATCAATCGGAGGAATCACTGTCTGGAATTGAATCACGGCCGGGTACATTGCACTCTT
GAACATCTTCGCTGAGGAGGCAACAACTCCACTCAAATGAACTATCGGATCCAGCGGAAGAGAGATCACTGTCCCCTTAGACCACGGCATCTGTTTCAGA
TAGTGCCGCAGCTTCTCTTCCTTTTGGTCCTTTCTGCCCTTTTCTTCGCGAGCCTTGTTGTGGATTGTCAATATATGACTCATGAAATCGCGCTGAGCCA
TTAGCATGTCGTAGATCGgtttcttctcctcgtcccGCTTCATTTCCGTTAGCATCTGGTTTAACACAGTGTGGAAGATCTCCGAATCGTTTGTTTGCTC
GCCGGCCTCCACTTTTAGGTACCAGTAGAAGTAGTTGGCCATCTGGAAATTTGTGCTCGAGCGGGCAATAAGGAATCGAGCCAAGGGGCCAAGGCTTTCA
CTAGGCATCGATCCGTCCGTGCTGCCGGTTTCATCCACGCTCATTGCTCCGCGAGAAGATATGATGGGAGCCCCAGGTTTCTCATACCGCAATGCTtgga
ccagctgcagcaggaagtcAAGCAGATCTTCGTTCTTGGCCGTCGCCAGAGTAGACACGGCAAAATGGCGCACGATCTCGTGCTTGAACTCTTTTTCAcg
gcccagcagcttcagggCGTCGGCGATATCAATTTCACACCATTGAGAAAGCAGATCCGTCGCTTGCTTCACCTCCAGTTCGTCTTTCCAATCAACAGAT
AAGAGAAATTTTACCACCGCCTTTTTGTTGTCTGTCAGAGTGTAGCGGAATTTCCAGAGCAAATCCTTGTCTTCATTCTTCAAGTTGTCCATCGGCGTTG
CCAGCAAGAGCTCGATGCGTGCCTTTTCGTCACGACTGGGCTTGAGATTGGGATCGATCGAACCGCGCAGGATGTCGCGTGCTAGCCGACGGTACTTGCG
TTCGGCTGGGTTGTCTTCGTTGAGGTCGGGGTCCCACACGGTCACCAGGCTCGGCAGCTCTCTGGAtccagaagatgctgcggtCGTGGCCAAGTCGTAC
GACCCACTCAGCGTGTGCGAGTCGTAGGACGGAGCCGCCGATGACGATGTGCTTCCGTTGTCATAGTTCATCCGTCTAGGGCCCATGTCTGCAGTGTACG
ACGACGTCAGGTTGCGCTGCGAGTAGGGCTCCTCCTCGTACACGACGACATCTCCGAAGTACGGCATCtcgagccacagcagcgcgTCTTCCCGGTACGA
GCAGAAGGGTCCGAGAGCGTCCTTCCTCGTCGGTGGTTCGCTGCCCCGTCGGATGCGAGCGATGCGTCGATCCGTGACGCTGTCCATCCACTCGTTGCGC
GCGATCTCCTTGCGCTCGTACTTCTCGCGGAGCTTGTCCAGTCGGAAACATTCCTGCCTCACCCactcctcgtcgatctcggaCGGAGTTGTGGTGTTCG
GGGACGAGTCCGCCTCGCGGCCTCCCCAGATGCGGAGACACTGCACACCATCGCGCAGCACGCCCtgcttggagaagaacgagatggTGGAGCCGCCGAT
GGGGACCCAGCCCACGCCCCAGATGGTgatggccagcagcgagttgcgCGACAGGTCACGGTAGCGCACGGGGAAGGAGATCCATTCGTTCCAGTAGatg
gtggagttgctgcacttgGTGGGGCTCTTGGAGCTGAGGAGACGTATGGGCAAGTTTATCAGCTTCTATAGCGCTCCGGACACAGCAGAAAGCAGGAGCA
GAGAGTAGAGAGTAGAGAGGCGAGTGCGTACCTGATGACCATGGGGTGCAGTGGGAGGCCGTCGGAGAACACCTGCGCGGTCAGAAAGATCTCGCTCACA
GGCGAGTTGCGCACCTCGGACGACGTGCctgcgagctgctccaggcCGGCGAGCGGCGCCTCGGACACGGCGCGTTTGGGCGCGTCACCGCTGACAGAGC
ATCCCAGCGCGggcgccagctccaccagcgagATCTTGACGGAGATGCCCGTGctcacgccgctgctgaggTAGTAGCGGTACTCCTT