Description :
From Genome Similarity Track
Location :
Scaffold_13:68620- 72400
Transcript NameFunction/comments
Physo_130827reverse transcriptase

Sequence
3780 bases(100 bases per row)
GACGCTGACGAAGCTACGGTGTACTTCCATGAAGGCACAGAATTGCTGAATGACCTCCGGGACCAGTTTGCTGCTCTTCCGGAGTTGAAGGATCTCAGCC
CAAACGCAGACCTCTCAACGGCTAACGTGGGAGAACCAGGCGTTACGACTCCAGAAATGGACGCTCAAGTGCGAACGATTTTGGAAAGACATCATGCCAG
TTTTCTTGGGGACGGGAATGCAGTACCGGCCACTGCTCGTGGAGTTGTCTGTGACCTGGATGTTGGGGACGCGAAGCCCATCGCTCAGAGGTCTCGGCAG
GTTCCGACGCACTTGCTCGACAAGGTGTTCGCTCTGATCAAGAAGCTGCTGGAGACTGGGCTCATCAAGTATTCGCACTCAGACTGGGCTTCGCCAATTG
TGATTGTGATGAAGAAGAACGGTGCGGATATCAGGCTGTGCATCGACTATCGACTGGTCAACCAACTGATCAAGCTCTCACACTACCCTCTGTCCTTGAT
TGACGATCTGTTGATCGGGTTTGAGGAGGCGATGTGGTTCCTGAGCTTGTACATGACCAGCGGGTTCTGGGCAGTGCCGATGACTCTCCGGGCTAAGCTG
ATTTCAGCCTTCATCTGTCCTTTGGGACACTTCCAGTGGAAGCGCATGCCGTTTGGTCTCAAGAATGCCCCGCTGATGTACCAGCAGATGCTCGATAACT
GCCTGTGGGGCTTCGTGCGACTTCCGCCCTGCGAGGAGGCCCGAGTTGGCCCGGACGTGCTGGAATTCCTAGACATCGAGGTGGACGACTCCGCTAAGGA
GGAAGAAATCTCTCCTCTGTCTGAGGAGACTACCGTGTTTCGGCGAAACATTCCGGCCCCGCCTCAGCTGAGTCCTGTTCTGGGACGAAGCTCCTACATC
GATGACATCGCGTATGGAGCAGAGACCTGGGACCAGATGTGCGAAGTCTTGGACCGGTTGCTTTATCGACTGAGGTACTGGGGGATTTCGGTGAGCTTGC
CCAAGAGCGAGTTTGGCAAGAAGTCTATCTCCTACCTCTCGCACGAGATTGGAGCTGATGGAATCCGGGCCAAGCCGAAGATTGCCAAGGGAGTCAAGGA
CCTGCCATTTCCGTCGACGCTGAAAGGAGTGCAGTCATTCCTGGGAAGTCTCAACTACTACAACAAGTTTATTGAGGACCTCCCGGTTGTAGCGTCTGTG
CTCTACGAGTTGACGGATGAGCAGATCCAAGCTGGACGCGATCTCGGCCGAGCTAAGGAGGCGTTTGAAATCCTGAAGTAAAAAATTGTCTCTACCCCGC
TGCTCAGACACCCGAACAGGGAGAAGCCGTTCGTGATTATTCTGCACGCTAATCCCTGGGCAGTATGTGCGGTGCTAGGCCAAGAGTACGATGGAGTCAT
TTACCCGGTGCGAAACACTGCATGACAGGATGCTCAGATACCACCCGGCTGATAAGGAGGTTGCAGCGTTGCTCCGAGTTCTCAGAGTCTTCTACTCGAT
GCTGAGTGGTTGCAAGCTGCTGAAGGTCTACACGGTTCTGAAATGGTTGTTCAAGTATCGGTCTCTAGAGGGACGCTGTGAGCAGTGGGCTGCACGTCTG
TCGCCCTGGCCTTTGGAAGTTCACAAGGTCGAACGCGATGAAGATGGTTTGGCCGCGATCATGGGAGCTGGGATCACCCCCCGTGACCAGTTGGACAAGA
TCGCAGAGAACCTCATCCCAGACAAGGGACGAGTTGTCCGAGCCCCACCGATCAGCTTGGAGATGCTGGAGACGGACTACTAGGGATGGCTGCTCAGCTT
TGATGGAGCTGCCAAACTCTCGGATCGCTCTGGTGCTTCTGGCTGCATTCTGTGGAAGCTCCCATCCTGGGACGTGGTCGAAGCTCGAGGATTCCACTTC
GAAGGCATTACGGTGAACGAAGCCGAGTACCATGGACTGCTCGAGGGAGTTCGCATGGCGAAGGCTCGTGGCATCTCAGACCTTGTGGTGGTCGGTGACT
CTCGGATTGTCATTCAGCAAGCTCAGGGCCTGATCCAGTGTCTGAGCCCAGGGCCGCAAGTGCTGCTGGCTGAGTTTGAAACGCTTCGCCCAGAGTTCCA
ACGATTGCGCTTGGTACATGTGAAGCGAGAATATAACGCAGCTGCGGACTACTTCACGTCGAAGACTCTGGTGACTGAAGGTCCTGTCGCCATTGAAGAT
CCGGTTGAACTGGTTCTGCTCAAACAACTGAATCGGATCCCGGAGAAGCTGATCAAGGTGAATGAGACTGAGCCTGCTGAGCCTGAGACGGAGCAACCTG
ACACTCAAGCTGATGTAGAAGTGGTGGCTGAGCCAACTCCACTGGAAGATGCTGCCAAGCCTCTGTTGCCCAGCGCTAAGATCTTCGTGGTGACTAGGAG
CCAAGCTCGGGCCAGGGACGCTGAAACCACAGCAGCCAGGGACGAGTCCGACCAAAGTGTCGATCCTGACCAGAATGCTGAGCCCCCCGCTGACCAGGCT
CCAGTGTACTCACCTGAAGCAGCAACTCCTGCTGCGTCAATCGCTGAACGATGGAGACGCATCCTAGTTCTGCAAGAGGCTGAGCCTTGGACGAAGAAGC
TCAAGGATTATCTGAATGGAGACTTGGGGAACCTCTCCGCTACTGAAGCGGAAGATGTGGCCAAGGTGGTGGACCAGTTCACCCTTGATTCGAGAGGAGT
CCTGTACTATCTGAGTCGAGCTACTCCGGGAAGGCCCAGGGACGCAGTTGGGAATCTGAGATTGGTTGTGACAACGGCGCTGAGGGATGACTTGCTTCAG
CTCAGTCATGAGGAGTTCCAAGGTGGCCATCAAGGGATCACTAGGATCTTCGAGCGACTGTGCAAGGAGTACTACTGGCCGAGGATGTACGCCGACGTGG
AACACTATGTGAAGGAATGTGTGGATTGTGTCACTGCCAAGGGAGCTCCGCCCAACCCTGGGCCATCGCCGGGAATCATTTTGGCGACTAAGCTCTTTGA
GGTGGTCTCTATGGACTTCGTTACGCATCTACCCAAGTCTGACCGTGGAAATGTGTTCCTGCTCCTGTTCCAGTGTGCATTCTCAGGCTTCATCATGTGC
AAGCCGATGAGTCTGACCACAGCTTAAGATGTCGCCGAGGCCTACATGGAGTGTGTGTTCCAGAGGTTTGGTGCGAGCTCTCTACTCCGCCATGACCGTG
ATCCACGTTTCATGAGCGAGGTGTTCGCCAGGTTCCGCGAGATGCTGGGAAGTCGGCAGCGCGCGACTCTGGCGTACAGACCTCAGGCAAATGGCCAGCA
AGAGCGCTCAGTGCAAACAGTGGTCCGAGCTATCCGAGCGTACGTCGCTGAGCCAGATCAGAGCGACTGGGACGACCAGGTAGAGAAGTTGATGTGGGCT
CTGAACACGTCCTTTGACGCCACCCGTCTCGACACGCCGTTCTACCTGGTCCACGGCTGGGACCCTCATAGCACTGTTTCGGCCATGCTGGGACCATCTC
CGACGGGCTTGGATCAGAGGACTGCCTATGAGTGGCGTCGCAAGACTCAGCGCGAGTACGAGTACGCTCAGGCCTGGGCTAAGGACTTACAAGCTGAGGC
CAAGGTCAAACGCTCAGCTGCTCAGACAAAAATCTGGGCTGAGCTGTCCGAGAGACTCAAGAAGGATTTCGACGTTGGTGATGCTGTGTGGCTATACCTA
GCTCGAGTACAACCTGGGCTCACGAAGAAGTTCGCTCACCTCTGGCACGGTCCGTTCCGGATTCTGGAGACTTCAGATGA