Description :
From Genome Similarity Track
Location :
Scaffold_148:68619- 70808
Transcript NameFunction/comments
g14656.t1hypothetical protein
g14657.t1hypothetical protein

Sequence
2189 bases(100 bases per row)
GGCATTTACCAACTGGAGCATCGGAGCGACAGCGGAATCCTCGACCGAACCATGACGATCGACAGATTCTACGGCAAGGGCATGAAGAACAAGCACGCGC
AGACCGTGGCGGCGCTCAAGCAGAAGGTGGCCGAGCTGAAGCGGGACAACGCGGAGCTGCACAACGCGCTGCAGGCCAAGGACGAGCAGATAGCCGAGCT
GCAGCGCAAGATGGAGACGCAGGCCGACCAGGCGTCGACCTACAAGAAAGACATGGACGCACTCACGCTTCTGGAGCAGAAGGTGGCCGCGCTCTCGCAG
CAGAACGAGCTGCTTAGTGAGGAGCTGCGCGCGAGCAAGCAGCAGCAGCAGACGGTGGGCAATCTGACGATGGACGATCTGAGGCTCGAGATCGAGCTAC
ACACCATGGCCACGGAGGCGTGCCGGGCAGAGGCCTACGAGTCTTGGGTCCTCCGGCGCCGCCTACAGAAGACACAGGACGAGTGCGTCAGGCGCGAGAA
GGCCAGGAGTGCGGACTGGGCCAGACACACCAAGGAGCTGGCAGAGGCCAAGGCCGACAGCGACGCCTTCGAGCAGATGCTGGCGGTCCTGATCCAGGAG
AAGAAGGAGATGGAGACGCGCTACAAGAGGAAGCTGCACAGCAAAAGAGTCCAGCTTAAAGGCATGGCACAGGACGCGGTGGAGCTGCATACACAGCTGG
TGACGCTGGAGTTGGAGCTGGAGAAGAGGCAGAGTGAGGAGACCAGCAGCGTCAGCAGTCCCACGACGGTGAGCTCGTGGAGTTCGACCGAGACGGCGGC
GGAGGTGGTGCCGGCGCAGACGCGTATCCGGCAGCGGGAGGAGGAGGTCAGTGACAGCGACGGCGTCGTGCCTAAGAGACGTCGGGTGGACGGCAACGCC
ATCGCATTCGACAACCTACGACTAGTTCGGTGAAAGCTGGACTCGTGCATGGCGGATGCTGCAGCAAGAAGATCACGATTGGTGACAGAGGCACTCATTT
CTGCCTCTCATCGTGGACGTTTCAGCTCTCCGTGGTCTAGAAGCTGCACGATGTGGGACTCATTTCTCCCGCGTGGCAGCTCTCCAGTTGGCGAGGCAGA
GACTCGTTTGTGTCTGTGGTGCGGTAGTCTGCGGCTTCTCGCTCGTTGAAGGTTTCTGTGCGTGGAGTGCCGAGGCTTGGTAGGCCTTACGTGAAGTTGC
GCCAGCAGGCTCAGTTGATCGGGGCTCATTACCCTCGTTCAAGCTGTAGATGCTGGCGTACTTCGCGTGAGGTGCGAGTGTGGTGTGCTTTGCAGTGGTC
GACAGGGACTCATGACTCTCTGTCGACCACTGTGATTGTGCACTTGCTTGCTCTCCTACTTCGCTTCGGCGCTTGCGTCCGAGGCTTTCGTCGTGTGAGG
CGCCTGGATTCCGCTCGCCGAATGGACTTCTGCTACCGCCACATGCTGCTTGATCCGACAAGAAGACTTGGATGAACAATTGCTAGCTAGGAAGACAAGT
TTGTACTTTTACATATCGTAACGCAGTGGCAATATATTTTGTTGAGCCAGCAATGGGATCTATCAACCTTGTCTGTCGCGCTCTCTCAGCCTTGTCTGCC
ACGAGTAAAGCACCCGAAGACTGGAGCGTGCACACGTTGCCTCAACTACAACAAGTGACTAGCAAGAAACAATACTTCCACTCGACACCGGACCCTTGTC
CCGCCGTACAGGTCGTACCTCTATAGCCTGCAGTCTGCAGCAGAAAATTTGAATGAGTTTAGTTGTGAAAGTGGCGAAGCACTGCGTCCGCCATGAACCG
ACTCGGTACAGTCGGATGCCACGAGAAAGCCTCGTTGAACGCCGTCATGTTGGCCACGGGTGCTTCACGACGCATTCGAGTGTACATCTCGGGCGAGTCG
TCCACGTGCGCAACGTACTCGGCGCAATCCTGCAGACTGTCGAATCGGCCACAATCGATGAAGCTCTCGGGGTTAAACAACTCGGACACGGTCTTGGAAT
CGCCCCAGTACACGGGCACACTGCCCGCCAGAAAGGCATTCACCAGCTTCTCCGTCACGTAGCCCGCCGCGCGCGTGTTTTCAAAGGCGAGCACGAACTT
GTACGGCGCATACCGGCGCACCGCGTCGTCATTGTAGAAATTGATCATCGGACCCATTTGAGGTGATGAAGGCACACGCAGTGAAGTTC