Description :
From Genome Similarity Track
Location :
Scaffold_986:6861- 9104
Sequence
2243 bases(100 bases per row)
CGTGATTTGGCCGAACGAACTGCCGGCTTCGCATGCTAATGCCAGGGCAAGCCACACCACCGTGAATGCAGACGGCAATAACATGGCAACATATTGAGTG
ATTGTGGTTGTACGCACTGCTCCTTGTATCTACTATCCAGCCTCCAGCAGGTTGATCCTTCTTTTGCATGCGCCTGGCATTTACCGATCGTATAGAGTTT
GTAACCAAGTGTTTCTCAGCGGCTGTAAGACGCAGTGGTGATTGCTTCACTCTGTATAGATCGGCTTGAACAGATCCGACATGAGGTATACGATGGACCG
AAAGACATCCTCGACGGTGCATTAATCAATAGAATCCCATCAGCCGATCCGAAGCCCCGACTCCGATTTGAAATCTGTATCACTGTTCAGAAACGCGAGC
CGCACCCCATCCAGATTTTTGATCAGTTCGCTGGGAGTAGCCGGGCCACCCGGGCACTGTAATTTGACCTTTCGGTGATACTGCTCGAGAGGGTTATTGG
TAGCAGCGTAGCCGCTGGGTGTTCGAAATGCTTGCCAGTGTGAAAAGCGGTGCGAACTCACCCACATCCTCGTTATATGATCGGTAAGCTTGCGCGCAGG
GGAGCCATCGGCAAAGTTTCTCCATTTCGCAAGCACAAGAGTTTTCACAGTTGGAAATTCGTCTTCGCTAGCGTAATGCATGTCGTACAGATCAGCAAAT
ACAGTTCTAGTATCACCATCGCCGACACTTTTCGCACGTGAATGAGTTCATACATTCTTCGTTATGTGAAACCAGCACATCAGCACGGTTGCGTGCGGCA
ATTCCGTAACACAAGCATTAAACTGCGCTATGTCTGCGTCCATCATTACAAATTCAGGGGCAAATTGGACACAGCATACATCCAAGCACACACGCTTTAT
GTACCGGATACACCACCCGATATCGACCGCTCGTTTCTGCGATGTACAAAAGTACACCATCGGAAAAAAATTCCCACCTCGATCCGAATACCCAANGATG
TACAGAAGTACACCATCGGAAAGAAATGCCCACATCGATTCGAATACCCAAACGCAAAAACAACATAGCTGTTGATAACCATGCTGTGCGTACTGTCGAT
ATGGAGTATTGTCGTGCAATCCGGGCGATTCTGCACAGCTATGTAGTTTCGGATGAGACGAAGACAGGTCATTCCAACTCGTAGAGGATATGATTTTGAG
CCATCACCGAGATGGGACACGCTTCCCGTTTCTCCGTACTTGCGCCAGGCTGGGAATCGCACAAAATGACGCTGTCTGTGTCTGGTAGAGTCTCCAGATT
CTGCTGGTCGTATAGACGACCGTCACAGAGAGCAATCATTGTGGCGATGGAGTCCTTGCGGTTCTTGCGCCTCCAATTTTTAACAAAGTCTGCTACTTGC
GTGATTCTTGGCGCAGGCCCAGCCATTACGTTGTCGTCAACGAGAACACACAGCAGAGTGAACAACCGTGCAGCCGTAGTTTTCTCACCAGAGTGAAGAC
TCTCAACAATGTAATTTTTCATTTCTTGTGTCAATTTGCACTGTACCGGAGTTGGAAGGTCGTTTATGTCCATTACGTGTTCGCTCTGTCGAAAGACCTC
GCATGTATTTGACGACAAGCAAAGCTTGAACTTGTACCGACACAGACAGGGCGCTTTGGATCCTGGATCATGGTCTCTttcgcgttgctgctgtgatTTG
CAGCGCTTGGAACGGCAAGGCATTAGCTGGGATCGCATTATATGATCGCAACGATGGAGAGTATAGTCGTGGCCGAGTAAATGGTCAATAGCACAGTTAA
CTTGGTTACTTTTACCGACATCATGAGTTGGGAGACTTGTCCGGTAAACAGCCAACGTGTCGGGTGCGGTCGGTCGCCAAACACGAGTCCATGGTAGGCG
TCGACGAGGTTCTGTGTCGCCCTCAGCACTGGAATCCCATTCCTCTAGCTGTAAGTGACCGTCAAtatcttcgtcgtccatggtgtTGCCTCTGTATGTT
GCTTGTTTCTGTAGAGAGGATTAGGATGATCAATGATGTATGAAAACGAAAGCTGGCGTTGCACATTATAAATACAAAGTGCAACAAGGTGAAGCTAAGT
TTCTATTTTGGTGATCGTGTATTTTTGCTTGGTGGTGGAACACTTTAGATCGGGTGGCGGTGCATTTTTCTGTGTAGGTGATCCTTCCCATGATTATGGT
GGAGCTACACTTTTTTTGGGACACAGCTACAACATTATGTTGA