Description :
From Genome Similarity Track
Location :
Scaffold_1115:686- 4189
Sequence
3503 bases(100 bases per row)
AATTTCGTAGAAATCAGCTTCCCTCAATTCGTACNNNNNNNNNNNNNNNNNATATGGCAAAATTTTCAATGAACCGGCTGCAGTAATTCAGGTTTCCTAA
GAAGGACTGCATCGACCGCAATGTCTGGGGAAAGTAATATTGACTAATGACCCCAAATCCTTCGGGTCAGCTTCTATTCCTGGTAATGAAACTTGGTGCC
CGAGATACTCGACCTTTCGTCGTCCCCAAACACTCTAAGGTAAGCTGATCGAAAAATTCCACTGATCACATGCTTCCAATAATCTGTTCACCTCTTGATA
GAAAGACGTCCAGGATGACGCCGGAATTAGAATGTCANNNNNNNNNNNNNNNNNNNNAAAACAGAAGGCCTTCGGTGCGAATTTGGATCGCCGTCTGTAA
GCACATCGACCGGTCGAGAGACCTTGTGATCACTTAACCTCTGTCGATCACCGATCGTGAGATACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCGAAGGCGCGATAAAAGCGGAGACCATTCGTGCACTTTCTGTCATCTCCACA
ACCCAGAATCCGCTAGTCATGTTCAATGAACAGTACCTAGCGCTTCGTCCAGATCTTGCAATAAATCAGTGATTATGGGCATGGGATATGCCATCATCCT
CTTCAATAGATTGACTCTTCGGTAGTCAATACACAGTCTTATATCCACCCCATTCTATTTCACGATCGCTACGATCGGTGACGCCCATAGTGAAGTTAGG
GGACTACTGATTTTGGCCGATAATAACCCTTTGATCGCAGATGACGCCTCGAGCGGCAGGTGGCAGGGCGATTCCTTTACCCATCAGGAGGTGTCATTTC
TTCCATATCGGCCGACGTAATTCCTCTTGCTCCTTGGTCAGTGGGACACCCGGGTCGCCCATCTGTATGTCGTCATTTTTTATCTCATCCGGCCTCACAT
CCTCTTCTGGTAAGATTGCCATATATTGTCTAACATCCGCTGCAAACAACACTCCACTATCATGATGATATTACAAGCGTTCGCGTGCTCCTTCGCTAGC
GATCGTTTTCATTTGGCTAGTCTATTGGTCGGAATGTAGATCTTCATCGCATTCCTTGCCAGTGATCACGACTAGGTGATGGGTGGACCGGTTTTGCACG
CGATCAGATCCTCTCTCACTGTCCAGATCGGAAGTGATTTCTTCGAAACAATTCGAGGCTGTGCTTCCGACTAGTCTCGCAACATCGAGAAGTCTTTATC
AAATCGGGGGCGCTGTTCGCGTCGGTCGTTACTGACGATCGCTTCGATATATTCTCTTGGAGTCACTCTGTTGCTCCGGCTGATCAGGAACCGACTACCA
AACCACATCACCATCATTACCATCACAAGTCGTACCAGGTGTGGTGATCCTGTTGATAACTACCGGTGGCTGTCCTGATTGTCGCCTTTCGAGGTCATCT
TGTTTTTCTATGTGATCATATCGGCGTGGTACCTTCTAGATTTGCTTCTTCTGTTTCCATGGTCGTTTTTGCTATATCCTTCTGCGGTCGCTTTAGAATA
TGCGTTAGCGTTGGATATGACGGGTGTTCAACCAGNNNNNNNNNNTCTTCAGGCAATGCCTCTCCTTCTTTTTCCGTAGTAGCTTCAAACGCGATTGTCT
GCCACTCCTGATATTGTCGTGACCCCATGGAAACATTCCCGGGTGATCGCGGTATCATGTCCTCCTGGAATTATTGTCCGAAGGGCGTCCCTTGTTGGGT
GATCACCTCTTGATCACTAAAGTTAGTCAATCACAGGTACGTTAGTCCTCCGGGTTCGGTCGTTGTATTAGGTACCCAGCTTGAGTGTCATTTTAACCAC
ATTTCGACTGTGGTGGCCCCCGACCAACATTGACTTCGACAGAGTTATCTACCGGGATCGTCAGGTACATCTCATCCGCGGCAATCCGTTGTATCTTCGC
CCCATACTGTGGACTTCTTCCTTCTAGTTGAATCCTGACATCGTCCGGCAAACAGACCGTCCCGTCGGCTAGGACAAGGCTTATCCCGGTGGGTACCATA
AAGTCCATCCCCGAAATCGCTTCTTGCCCACTTGGTCACCAACCCATATATGGAAGTAGTAGACTGGTGAACCGTTAAACGTGATCTTTACTGTCGTGCG
GCCTTTGGTCATGTACGAATTCTATTTGATACCCACGCATTCTTGCTTCTGACTATCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCTGCCTTCGCCTTCCTGAACCATTTGTTTGGAGTGTGATACTTCCAGTTACC
ATGTGATTCACCAGGAGACAACTCGAGTTCCATCCTGGTAGGTGATCGTGCATATTCATTCGGTCGCCTCATACTTGCGATTGAAGGCAAACATCTTAGA
TCCAAATCACATGTACTGGAAGTCCGACCGGTCAGGCGATTAACTCTATTATCAACCCCTTTTCTTTCAATGAATGCANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGTGACCTCGGCGTCCGCATTTCTAAAAGTCAATCGTTTCCAGAATCCACGATCATCATGTCTTTTCGACCAACANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNACTTGAAGTGTATGGTGATTTCGATCGTGAGAGGAACTTGCTTGAACTGGCTGGGAGGTTGCCGTTGCGTTTCTGTATACGTTCGTACGTGT
GTAGCGTTGCTTTCAGTGTATTCACGTCATTTAATCGCAGCGGCGTTAATTGTTTTGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATTATAATGGCGACCAGCGGAGACGTCGATCGACTCAATTGAGAATACCAGTTTCGTGCTGGGCC
TGT