Description :
From Genome Similarity Track
Location :
Scaffold_2015:686- 2959
Transcript NameFunction/comments
Phypl_g14547hypothetical protein

Sequence
2273 bases(100 bases per row)
TCGCTCAATAATTTTCATTTAATGGCGATCCCATTGTTTGAAGAGCACATCGGCGAGCTAATGTTCGAAGCCTTGTCAACATTTCTAGACGCTTTAATTC
CAGTGTGGAGGCAAGTACTTGTCGGAGTCTCCACAGACGGCGATAGCGCCATGACGGGTCGTGTTCGTGGCTTAGCGACTCGTATTGAGTCGGCCGTTCC
TGCAAAAAAGCTTATTCGGGTTTGGCGTGCCCTGCATCAACTCGATCTCGTTATGCAGAAAGTGCACAAGTGTTCACTAGATGATGAATACCTGTCGAAA
TTGTCATCTATGTCTGGACATCTGCGGCGACAAACCACATTGATCGCCAAAATGCGATCAACTTGTCCTCGAATTGCTGATACGCGTTGGCTATCAATGG
AAGTATTCTGCACTTGGGTTGTGAACAATATCATTGAGCTTCAAGAGTACTATGCGATTAAACTTCCTCGCCCACCCTGTGTTCCGTCGATCCGCTGGTG
GGTTTTTGTATTTGCAGTTCAAGTATTGACATCGGAGGCAAACTTTGTATTCGTACGACTACAAGGAAAGACCGCCTTGCTTTCGCAACAACGTGCTGCG
CTGAGTATTTTGGTCTGTACATATTCTCGCCTGACTGGGGTGCAAGAACCTTTGACGGCTGATGCCCTCAAAAAGGTTGATCAAGCTCGTTCAGAAGTCT
GNGACCTTTGACGGCTGATGCCCTCAAAAAGGTTGATCAAGCTCGTTCAGAAGTCTGTGGAGTCGTCGCATTAAGTCACAATTGCGCTCGAATTTTTCCT
ACACAGCTAGATCCATGGCTCGAAGAAACTCTGGATAATCTCCctgacgaagatgccgaaTCACTattcgctgctgtcgctaAAATGTTTGTTCAAGCCG
CGGCTGGAATTGACCGAATTGTAACAGAGCGTACCGCGGATAACAGTGCTGGTCTCTCCTTGCCGCTGGTCTTGCCTCATCAGTTGGTAAACATGAATGT
GTCTTCATTTAACCAGCTTATGAGGGAGCATGAGCCACGTTTGCTCGTTCGCCTGTCAGAAGTTCAATTTCATAGGATCGGACAACAGCTTCCGCAGCTC
CGTCGAGCGTACGTGCGTGAGGAAATATTGCGCCAAATACTGGACTCGTTTCAAGACGAAACAACATCGTTTGAAGATGGATAGAAGCCTGTAGGTAACA
TCTACAACCTTTTAAGACAGTTTTGTGGAGATCTTGCATCCCCATTTCCGAATACTGCGACAGTGGAAAGCGATTTCTCTGTTCTaggctggagaaggac
ggTTATCGCAAACACATAACAGACATCTCTCTAGAGGGAGTTATGCACGCAAAGCAAATTCAATCACGGCAAGGGCTTGTCGAGAAGTTGAAAGTTTAGA
TATACCAATACATTTGGATGATGAATCCCATATTCCCATATCTGAATTCTATAGCTGGCCATGTAAGGCTTCAATATGTGCTAGGTGGTCTGACCCATAT
TTGTGAAGGCCTGCCCGCCACTGCCACTGACTCAACGCCCTCATGTCCCTATCCTATTAATTTGAATAATGAATTTGGATAGGGTTATGTGTCCCACGTA
TTTGCTGCATCATCATCCCAACTGTCCGAAAATGTAGGGATGTCGGAACCGTTGCGATACGGGTGAATATGACGACTTATCCGACCATACTTGACTTTTG
TATGGGGACCAGTGGCCCAGCAACGACCAATCACCGCATTTCATTTATAATTCACCTATCAGATGCGTTTGTTCAAATCGTTTTGACCAATCGCAATGCA
GAGAGTTTGGGAGGTCCTCTACACCAGCCGTTCCGACGTATCGGGTCGAAAGGACACGATAAATACGTGTATCTCCATCCAAACTACAAGTATCGAGAAT
ATCACTTGCATATTTGCTTCCAATCCGACCAATCCGACCAGGATGGGCTTAGCTGAGCTCAAGTGTGGCAACACCAAGCGTGTTAAGACAACAGCCAAAG
GTGCGTTCACGGCCTTCTGCAAAAGCGAAAATGTAGAGTTTGACTATGTTAAGCAATGCATTGAGCAAGACGCTACAAGAAAATGTTTTCTGTCAGTGCT
GGATAAGTTTGGCATGTATCGTGCATTTAACGAGGGTAAGAAAGGTCAACCACTTGCTCGGAATCGTCATGCAATACTTTAGACAGAGTAAAATGTTGCT
GTTCGACGTCTTCCCCACGCAACGACATATTATCAAAGCAAAGATGCTTAGCATGGGGAAGACTCTTGACAGC