Description :
From Genome Similarity Track
Location :
Scaffold_1698:686- 2918
Transcript NameFunction/comments
Phyag_g11291hypothetical protein

Sequence
2232 bases(100 bases per row)
AGCGCGCGTTGGAGGAGGCTAGGCGCGGTTCCCAACTGCGCCAAGTGGAAGGCTTGCCTCATACGCCGCCACGCGGTCCGGAACATCTGCAAGGATCACC
TCGCGGGGCTCCCAACTATCAGGCATTAGCCCCAGCCAAAGCACCAAGTATCAGCGATGCGGTGGGACTTGATCGTCGCGGACGCGAGCGCCGCGACCCG
GACTCGTatgctgcagagcagcacgacgatcGTCGTGCTCCAAGATCTCGTCCACAATATGACGCACGTGACCGTCGGGCGGAAGCTGATGAGGTgcagc
gtcggcgtcgagctcCTGATCGCTTGGGGCGTCTCGAGCGCGAGATGGCTGAGCTGCGATACGAGCTGGAGGGAACGCCGCGTCAGGAACCACGACGTCA
GGAACCACGGGGTCGCGACGAGTACTGGGACGCTGGTTGGAATCAGCGTTGCTAGGGATGACTGCTGGGTGATATCGGCGGAGGCGGCCGACGTAGAAGG
TTGGATGTAGACGGATAGCCGTGGGTAGTCGCAGCGTGTAGGCATCGCGTAATACCTTCGTCACTTTAAATGGGCCAATAAATCTTGGCGCGAACTTGTT
CGCGCCCAAGTTCGTCACAGAAGCAGGTTGGATACCAGCTGTGAACAATAACACATGGTCGCCCATGGTGAACTTCTGCAAATTCTTGCGTCCTCTTCTA
TCGGCATATTCCTTTTGACggacgactgctgctgcgatggcaTCGCGCACGTAGCGCACGACGGACTCCCTTTCCTGTACGAATGTGTTGAcagccgcag
cgtctcgtgACTGCGGCACCGGAAGAGGACTGAAGTTCGCTTGAGCGGACACGGGTATCGTGGCCGTGTCAGAAGTATCTTGGTATTCAATTGcgcgtcg
acgctgacgtGGATTGATCAGCGTCCgagaagcccaagctgcGAATGTCGATGGCGACACTCTCGTGGCGACCCGTTCACGTGTTGCGGCTGCATTGTTG
CCATTGGTTCCCCCAAATGCCGCCCACGTGGCGGTGCATGTGCGCACTCcctgcgcagcagcttgggcaGCACGACGCGTTGTAACTCCATTTGCCGTGT
CGTGAGCGCTCTCACGACGTTCACCACTGGCAGACTTGGAGACACGAGACGCTGTGCTAGTTGAAACAAATTGTGACGCGGATCCGCCTACGTCTTCAAC
ATCGCCTTCACTTGTTGGGTTTGAGCGCTCCACACCGAGGAGCGCTGGAACTCGAGGATGTCGACCATAGTTAACGTAGAACGGAGTAAGACCAGTCAAC
GCGTGAACAGCGTTATTCATTGCCAACTCGACCATCGGCAAGAACGAGCTCCAAGACCTGAATGACGTGGCAAAACTCCTCAGCACGTCCTTGATTACTG
TGTTCGCGCGCTCGGTCTGGCCGTCCGTCTCCGGGTGAGACGCGGTTAACATCTTCAACCGTGTCCCGAGCAACTTGAGGAGCTCCATCCAAAAGGAAGC
TGTAAAGCGCGGATTTCGATCGTGTCCGATCGAGATCGATAAGCCATGGTGTCGGTACacgatgtcgacgaagaTCGCCTCAGACTGTTCCGCGGTGATA
CTgacggcaacagcagtgATATGAACCATCTTACTGAAGCGATCAACGAAGACAAGCGCACCAGTGCGGCCTTGAGAATCTCGAGGCAGCCTGAACACGA
AGTCCATGCTTATCGAAGACCATGGAAGTGGGGCAACCGGAAGCGGTCAAAGTGGGGCTTGCTTCGACGGGTTCGTCTTCGCTCGTTGGCACGCCTCACA
TGAGCGTACCCACTTCCGCACCCACTTGTACATGTGGGGCCAGCAGAAGTCCCGGGTCAACGACGCGAAGGTCTTCTCGCGTCCGAGGTGACCGCCGCTT
GGAGTGTCACGGAATTCGTGAATCAGGCGCGCACGAAGATCGTCGTCccgctggacgacgatgcgGGGAGGGTCCGCGCGATCAACATAGTACGTCAGCA
GATTTCCATCCAAAGCGTAGCGATTGACGCGAGCACGACTGCGCGGGGGCAACCGACGTCGTGCTGTGTCCGACGGATCTCGCAGATACTTGATCAACTC
GGAGCACGACGCGTCCGAGTCTTACGTGGACGCGATTAAGTCGCGAAGCGGGCCGACCGCTGCGACCTCAACAGCAGTGACGTCTTCGGCGATGCATACA
GCGCACTCGTagtcgtcttcgtcgcgaACGGC