Description :
From Genome Similarity Track
Location :
Scaffold_266:686- 2393
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015083Protein of unknown function

Sequence
1707 bases(100 bases per row)
CAGTCCATACTTTGACTTGCTGTGGGAGTTCAAAGATGTTTTCCCCGACAAAGTGCCAAGTACCCTGCCCGTTGACCGTGACGTAAGGCACGAGATTGAT
CTCGAGCCCGGGAGCAAATATTGCGTGACCAGACAATGGCCGCTGCCCCGCGAGCAGGTCGAGGCTATCGACGAGTTCTTCGCAAAACGAGCCCTCGCCG
GTCATGTGAGAGAAAGCAAGTCTCCACGTAGCTCATCTACGTTTTTGTATGCGGAAAGCGGCTGGTGTCTGGCGCATTGTTCACGCTTTCAACAAGCTGA
ACGCCGCCGCCATTCCGGCACAAACGCCGATCCCAAGAAAGGATATCTTGATCGACTCCATGGGCGGCTCGACAGTGTTCTCAGCACTGGATCTGATGGA
TGGGTCTATCATATCTCATGCGAGAGAATGACATCCTGACGGCAATAAGTACACCCAGCGGAATGCTGTGGGAGTGGCTCGTGACGCCGCAAGGTTTGAA
GAATGCACCAGCGACGTTCAATCGTCTGGTAACGCATCTTCTGCGTCCTCATCGTACGTATGCACCGAGCTATTTCGATGGCATCTTTGTGCACAGTTGT
GCCGAAGGAGATCTTAGTGTCGTTGACGTGCACAAGAGACATTTGCGCTCATTGTTGCAGTGCTTACGAGACAACAGTCTGTATTACAACCTGAAGAAGT
GCATCTTTGGTGCCTCAGAGATTCCGATCCTGGGCTGCTATGTTGGCAAAGCTGAAGTCCGTGCGGACCCAGAGAAGATCAAGGCGATCGCCGACTGGCC
GATCCCAAAGTATGTCAAGAACTTGCGCAAGTGGCTTGGCTTGGCAAACTATTTGCACAAGTATAGCCACAACTATGCGACAAGAGTCCGTCCACTCACA
CATCTCTTGAAAAAGGATGTCGAATGGGACTGGACAAACGATGTCATGAATGCATTCATTGACGTGAAGGAGTCGCTTGTTCGCGCTCCTGTCCTGGTGT
TGTCGGACCACACGAAAGCTTTCAGTGTCGTGTGTGACGCCAGCGATTTTGCAATCGGCCGTGCGCTGATGCAGAAGGATGATGACGGCCATGAGCGCGT
CATATCATACCAAAGCAGACTGCTTAAGGCAGCTGAAAAGAATTATCCTGTGCACGACAAAGAACTGCTTGCGGACCGCGACTAACTCCTCCATTTATCG
CAGCGAACGGCGCGATGGCTTGCATTCTTCTCCGAGTTCAACTTTCGGGTCGAATACAAACCGAGAAACGAAAATGTTCTGGCGGACGCGCTTTCGCGCC
ATCCAGATTACGAGTCGAGCGTTGACAGCAGCTCCGACGCGCTGTGCTTGGAGCGCACTCTTGATCTCATGCACCTGAGAATCATTCAGTCGCTTTATTC
AAAGGACAATGAATGTCGTTTGATGATTGCTCACTTTGACGGCTCGTCGAAAGAGTCATTGCCTGCCAAACTCGAGTCAAAGCTTGCTCGGTTTAGTTAT
CACGACGGGTTGTTGTGGCATCGACTGTCCAACTTCGATTACCCGCGTATATATGTATCGCATGACCAGGATCTGGAACTTTCGATCCTTCACGAGTTTC
ACGATGCACCAGCGAGTGGTCATCTCGGGCGTGAAAAGACCTTCTTGCAAGTGTCTAATGTGTTTTGGTGGCCACACCAATACAAATGGGGGGTGACCAA
TTATGTA