Description :
From Genome Similarity Track
Location :
Scaffold_3170:686- 1971
Transcript NameFunction/comments
Phyta_totarag15119hypothetical protein

Sequence
1285 bases(100 bases per row)
ATCCGATTGCAAAGTCGGACGCGTCACACACGACGTGGAATGGACGATCTTGATCGATCATCGCCAAGATCGGCGCCTCACTCAAGCCCCGCTTGACTGC
ATCGAATGCTATTTGGCAATCGATGGTCCAATTGTACACAGCTTCCTTCTTTAGAAGCTGTGACAGCGGGCGAATCTTGCCCGCGTAGTTCTCCACGTAC
TTGCACAGGTACGTGGCAAGTCCAAGGAACTGCCTCAGTTCCTTGTCGTTGAATGGCCGGAGCCGTTCTTCCCGACGAGACACCCAAGCACGGGTATCTC
GCTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTATGCTTACGCATCATCTCAAACAGCTTACGGAGATGCACCTTGTGCATCTCAACATCC
GTCTTCCCGTTCACAGCCCGGCTGTGAatgaacacgtcgtcgaagtagctCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGA
ACGTCGCAGGGGCGTTCTTTAACCCCTGCGGCATGACGAGCCACTCCCAAAGCATACCGCTTGGGGTGCTTACCGCCGTGAGAGGGATGTCGCTCTCACG
CATCAGGATCTGATAGAACNGCGCCAGCCGCCGTGTGGTTTCTTAACACAGAACGTCGGTGCACTGTGCGGGGACATGGATATCCACACTTGGCCTGCCT
TGCGACGACTCTCAAAGAAGTCGTCGCTTGCTTTTACTTGCTCTCGCGACAGTAGCCACTGCCGCGTGACACAGTACTTCGTGCCCGCTACGAGGTCAAC
CTCGTGCTGAATTCTCTTGTCCTGCGGGAGTTCCGCAGGNACTGGAAGCGACGTCAACTCCGACGCACTCGTCGGAGGGCTCTCAAGAGTAATACTCCTG
TACTGAAGCCCAGTACAGGTCTGCGTCAAGACATTCAATGTCTCGACGCTCGACGTCGGAACTGATGTCTGCCCGGCAGACATCTTGCTTAACGTATCGG
TCCCGGACCGAgtctcgcgcagcttcttcagcttgcgctgtcgtttcttcttgcggagCCCGGGTCCGCTTGTTCCTCGTCCACACCTGCTTGACCGGGC
ACTGGACGGGTTCGCGTTGTTGTCGCCGGCGGATTCTATCCGCGGGCGCGCGTCATCAAGCCCGGCTTGATGtgccgcttcttcgtgcagcccgGCTGCA
CGAGAGTTCGCAAGCTTGTTTTGTGCTGGACGTTTGCAACCGTCCGCACTGCTCGCAGCATCAGCTCCCGGAGCTGACTCGCCTT