Description :
From Genome Similarity Track
Location :
Scaffold_1138:6857- 8577
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1138-snap-gene-0.2Possible ribosome assembly protein 4
Pytul_var.sporangiiferummaker-pug3_contig_1138-snap-gene-0.3Conserved gene of unknown function

Sequence
1720 bases(100 bases per row)
GAGGAGCTGCTGCAGTACAAGCAGTTCTTTGAGAAGCTCGGGTACAACGACATGACGACAGTGTTCCAGGCGATCGACAAGGACGGCAACGGCCACGTCT
CGCTCAAGGAGCTGCTCGAGATCTGCTTCCACTACGCGACCAAGTACCAGATCGAGGAGATGCTCACTCTCGCCAAGGTCGGCAGCGTGCGCTCATATCT
GGAGTGCGAGTATGGCGCAGGAGCATCATTCCCTGGTGCACGAGGAGGCGAGACCGCCATATCTGCTGNNNNNNNNNNNNNNNNNNNNNGCGAGCTGCTC
GAGATCTTTCGCGTGTTTGACAAAAACGGCGACGGTGGCGTGAGTCGGATGGAGCTCATGGAGGCGCTGCGCGTGGACGACGACGACGTGATGGCCAGAG
TGATGACGGAGCAGTCGACGCATCATGGCAGTGGCACGGGGGTGGACGCGATCTCGTCCAGTGGCATCACCAAGGACGATGTCGAGCGCCTGTATGACGA
ATTCGACGCCGACCGCAACGCCTCGCTGGATTTTGACGAGTTTGTCGCGCTGCTGCGCACGCTGTACGGCCCAAAATCCAACGCCTACTTCCGATAGCAT
CCATCACGCAATGCAGCAGCCCTTATCAGCCAACGAGCTCCGACGTCTGTGAACGTGTTTTTATTTTATTCTCTATGTACTCTGGTCGACTGGGTACTGC
GTTTCTGGTATTATAATGGCTACATATTGCTCTCTTGTAGTGTCTACGGAATGGCTGATGCCGGTTCCTTGCGCAGGTAGTGGTGGCTCTTGGTGCGCGC
GAATTCGCGGAGCTCTTGCATCTTTTGCGCAAAGAAGATCGTGTCAAAGAGGAACTGCTGGTGCGCACGCTGCGCCATTTCCTCGTAGTCCCGCGGCGTG
TTCTCGCTCAGCATCGCGTCGATGCTCGCGCACACGTCCTTGCCACGAAGATCGGCCACGAAGCCCTGCACATCCCGGAGCGCGTGCGGGTGCTCGGACT
TGCCNNNNNNNNNNCCGAGGAACTGCTCCTTGAAACCATACACCTCGGAATGGACCAGCACCCCCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACAAGAAGAAC
GAACCCTCAGCGATCACTTTGCCAAATTGAACGGCGTCCAGCTTGCCCACGTGCAGGTTGACGTTCTCGGCTTTCTGGATGGCCTCATCGAAGCGACTTT
TAAAGTCGTTCTTGTAGAGCTGTTCGGCGATATAGATGTCCACGGGTGGAAAGTGCGGCCGTTTGAGCCAGCAGTCGAGGATCCGCGATGTGCCTTTCTG
GATGCTCGTGCCTGCCGTGTGCGTAAAGCGCACGCTCGAAAAGTTCTTGGGCGCGATCGCATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGCGTGTACATGACCTGCGTGTTCTTCGGGTTGCCCTCCTGGCGGAACCACTT
GTTCAGGTACCGTGCGCAGATCGCCGTCTTGCACAGCACGACGTCGGCCTTCCAGTAGTNNNNNNNNNNCTGGAGCTCATACATCTCGATGTTCGGCATC
AGGTAGAGCGGCTTCGTGGG