Description :
From Genome Similarity Track
Location :
Scaffold_835:6856- 11295
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_835-fgenesh-gene-0.0Ankyrin repeat protein
Pytve_DAOMBR484maker-pve_contig_835-fgenesh-gene-0.2DEAD/DEAH box RNA helicase

Sequence
4439 bases(100 bases per row)
ATTGGGCTCTGGCGACTAGCGGTGGGCTGAGCTGCTCTGGCTTTGCGCGTATTGGGATCAGATTCGTGGCTGACCCAGCGGGTTGGCGAAGGGTAATGGA
GTGCAAGCAAAGCTCGTCAGCGCCGGCCTAACCGTCGATAGCGCACAGTCATCGGCAGTAGAAGCGCGGTTCGCGCTGTACAGCAACTATTGGTATGCAT
TGGTGTCAAAGTGGCGGTGATACGAGCAACCGTTTGACAGTGTGTGGTTGGTGGGGACATGCAGCTCGCTGTCGACCGATTCGGAGAAGGATCCATGGTG
CCAAGGCAAGGCGACCGCGACACGAGCTCTAGTGGTGATCGCGCTGTTGGTGTCCATCGCGAGCCTCGTGTTTAGCAGCATGGCGACGCTCGGCGTAAAA
ACTCCGACTTGGGATGGCGAGGGTCGCGAGACGACGCTCGTCAATCCCCTGCTCTGCTCGTTCTGCTCGCTGCTCGCGCTGCTGCTGGCCGTGATTACGT
GGTACCAAATGGTAGTCGAATACGACAAATTGTGTCAGTCGACCATGGCGATCGTCACGTTCACATGCATCTCCACGGGGTCTACTTATGCGGTTGCCAT
CGCTGCGATCCCTTTTGTGGCATCGACGTATTGGCTCTGGCGACTCGCATACTCCTACCAAGTGCGTGACAGCATGCGTAGAGTTCGTTGCGTTGTATTG
CGCTAATGATGCTCGTCGACTTGGAAGGAAGCAAAGAAGAGCAGCGAAATCGCCAACGTGTTCACATTAGCGGCCAAGACAGGTAAGCGAGCGGTTCTTG
TAGATCACCTATACACACTCCACTCGAGATTCATGGGAGCATGTCGCCACAGATAACGTCGACAACATTCTGTCTGCGATTGCCAACAAGATCGACATTG
ACGCGCTCGGCTCGGACGGACGCAACGCTCTGCACTGGGCGTGTACCTTGAACCGAACCAGCATCTGCCACGTTCTCCTCAAGAAAGGAGCCAACCTCAG
CATTAAGGACGTACGCAAAGTGATATACATCCAGAGCTTTTGGGTTGGAACCATTCACTTAGCTTGACTGCAGCAAGACGGGTGGACGCCGCTGCACTGG
GCGAGTCGCGTTGGTAGCCTCGACATTGTGCGGCTGCTCGCCAAGCACGGCGCCGACGTCAACATCAAAGACCGCTGGGGCACCACGCCGCTCATGCTGA
CGGTCGTTGGCGAAAACCGCGTGGCAGCCGAGACGTTGATCGAGCTAGGCGCCGACACCAACGCCAAGAATGTGGGTGGCGCGACGCTGTTGTCATCGGC
ATCGATTGTGTTGATTCGCATTGCTACATGCACCGATCTGTGATAGGTCTTCGGACAGACGCCGCTGATGCTGTGTATGGAGGCTGGCGCGCGACTCCAC
CAGCTCGGAATGACCTTCATCAATGCCGGCGCCGACCTCTGCCTCCAAGATGTGAGCTATCCGACTTTGCTTGCTATGAGATACTTTTCGAATTCTCAGC
GTTCGATTTCGAGTGCAGGCACAAGGAATGACCGTGGTTCACTATGCAGCCACGTACGGCAACGCCAACCTTCTCATGAACGTCCTGCAGCAGTGCGACT
CCGACCTGGTGGACAAACCCACCAAGGTGCGTTCGCCAGCTCCTGGCTAGCGAAAGTGAACAGAGAATGCTCACCAACTGTCCCTTCTGCAAGTTCGGGG
AGACGCCTTGCCAAGTCGCCAAGCTGCAGAGCCAGACCAGAGTTCTGGAGTTGTTGCTCAGCTGGCAGGCCGGCAACCCTGTGCTGCCTCCGCAGGACGA
CGACGACCAAGACAGCTCGTCCGAAGACACTGACGATGACGAGAGTTCGGACAGTGACAGTAGCGACGAAGACTCATCTTAGCAGTGGGAATGATCGGAA
AGACAACCACATTCCGTGTAACACTCGCTCACATCCACAGCACGCAACTCCACTCCACACTTTTGCCACCATGCCTCAGCCTGGCCACCAGCTGCATTAC
ACTGAGTTGGTGTCAGGGCGAAACCGCGGGTTCAAGCAGCACATGGCTGCAATGTTCACAACCGCTGCGACGTGGTCGGCCAGCTTCGCGCGGTCGTAGC
GGAACTGGTACAGCGCCTTGATCTGCACCAGGAGTTTGTCGGTTGGGGTCGACACGTTCAGCAGCTTGAGGATCGCTGCAGTCAGATTGTCGTCGTCGTG
CGTCACGTCGTTTGTGATCAAGTCCTGGATGACTTGCCCTTTCTCGTACTTGTCATCGCCGCTGCTGCGGATGATGATGTTGCTCTTCGTGATGAGGACG
GAATTACCCGCAGCCAGAGCGTTCTTGGCCATCATGGCCTTGGTCGGGTCGGCCAACGCGTCCTGCACCTGCGTCATGACATCCGGCACAACTGGAGCAT
CCTTTGGAGCCTGAACTTCAGCGGAGTTTGGAGCTTGGTCCGCGCAGACCGCAGTCACCACAACGAGTGCAGCAACGAAGAGTCCGACCAGCTTGGACAT
TGCGCAGACAGAATATCGCGTTGGACGATGCGGATCCGATTCGAAAGTGGCAGGCGATCAAGCACTTGCGGCGGCATGCCGGAAAAGGAAGTTGCGGGGA
GATTCCAATGAAAGCACGCCGACCTGCGCAGCCCAATTTCCGAGAAACAGCAACAACAACCAAGCAACGCTCCGTCTACTGTAGATAGATTTGATGTTCT
CCTCGCTCTTTGAACTTGCAGCATTCATGATCTAACTTGGTGCTCCGATGTCTACCACCGTCCGCCACCATTCCTCTGGCCGCCACCGTTCCTCTGGCCG
CTGCCACCACCGCCGCCACGTGAGCCGTTGCCGTTCCCACCTCGCGGCTCGTACGCCGAAGCCTCGATGCCAGGCACACCGAACAGGTTCATCTTCCGGA
GCGTCTTCTTCTCGAGCTTCGGCACCTCGCGGAGACCGATCTGTGCCGAATACTCGGCCGCCAGCTGCACGAGGTGCACGCGGTCGATGCGCAGACGCTT
CATGTGCGTGTTGTAGAACCCGAGCCAAGCCTGGTACGATTGCTGCGCCGACTTCTCGAGCTCCTTGTTGGACGACAGGTTGTCCATCACGCGACGCGTG
CGGGAACTAGCCAGCGCCGCCGACACCGCCGGCGGGAGCTTGTACTCGGTGAGCGGGAGGTCGCTCAGCTCCTTGAGCAGCGGAGCCTCAAAGTCAGCCA
GGACGAGCACGCCGCGGCCCTTCATACCCGCACGAGCCGTACGGCCGACACGGTGAATGTACTGGTCGCGGTCAGTCAGTCCGACTTGCAGCACGAGCGA
CACGTCCGGGTAGTCGACGCCACGGGCCGACACGTCGGACGAGAAGAGCAGCACTCGGTTGCCCTTGCGGAAGGCCTCGGCAGTCTTGGTGCGGTGCGGC
TGGCTCTTGCGCGAGTGGATCTCCAGCACGTTCGGGAACCCGGCGGCGTCAAAGAGCTGCGCGTGGAACTGGGCCGCACGCGCCGTCGGGAAGAACACCA
TGACCTTGAACGTCGGCTGCTTGATGTGCTCCGCCAGCACGCTCTCCACGACGCCAATCACATCCTGGAAGGGGGCGACGACGAACTCCTGCACGGCCTG
GACGTTCGTCTGCTGGTCGTCGTCCTCAATCGTGTCCACAAACACGTAGTCGTCGCGGAGCGCGACCTTCTTCAGCTCCTTGGTCGACGCAGGCAGCGTC
GCGCTGAACAGCAGGGTCTGGCGTTGCTTGGGCAAGAACCCGATGATCTTCATGATCTCCGGACGGAAGCCCATGTCGAGCAGCCGATCGGCTTCATCCA
GCACCAGCACGCGCGACCGACCCAGTCGTCCTTGGATGTCGCCCGTGTTCTGACCCAGATGATCTTGCAGACGGCCGGGCGTGGCGATCAGAATGTCCAG
CGGACTGCTCGACGTGAGCGTCTTCGTGTCCTTGCCGATCGAGCTGCCACCGACGAAGCAGGCGATCCCGAGCTGGTGGAACTTGGCGACGCGGCGAGCC
TCCGTGGCGATCTGCAGCGCGAGCTCGCGGGTCGGCGAGATCACGAGCACTGGGATAGCATTGCCCGACGCGCCGTTGCGCACCAGGTTCTCGATCACCG
GCAGCAGGAACGCGATGGTCTTGCCGTTGCCCGTCTTGGCCTTGGCGAGCACGTCCTGGCCCTCCAGAATGTGCGGGAACGTCTCGTTCTGCACGCGCGT
GAGCCGCTCGTACTTGAGGTCCTCCACGATCGCGCGCTTCGTCTTGTCCGAGATGGCGAGCGACGAGAAGAGCACGTCCGAGAGGTAGTCGACCGACGCC
GGCGGACGCGGAGCAGCCTCCGCCTCCTCCTCGGCGCTCACGTTCTCCCAGTCGTCCATAGGCTCGTCCGCCTTCGTCCCCGCGTCGTCTGCGCCATTGG
ACGCACCGCCATTCTTGCGACNNNNNNNNNNNNNNNNNN