Description :
From Genome Similarity Track
Location :
scaffold_502:6856- 8487
Transcript NameFunction/comments
g8827.t1 hypothetical protein PHYSODRAFT_424253

Sequence
1631 bases(100 bases per row)
TTCTCTGGCAGAGACACCGACGGAGATCGTGCTCGAAGCTGGCTGGGCAAAGTGAAGTCCGCGTTCATCCGTGATCAAGCTCCTGACAGCGAGAAGTGCA
TCGTTTTCGGGAACCTGCTCACTTGTCCATCACGCGACTGGTACCAGCAGTTGGGAAGATCGACGCGTGGCAAGTAAAAGGGTCTCAAACGTTACGGAAC
TGACCCAAGGACGGCGATCGACGAGAAGGAGAAACTGGAAACCTTGGACGATCGCGATCTTGCGGACCAGAAAACGTTCCTGCGCCTTGCAGATGGCGGA
CGTGTTGCGCATGCGTCAGCGGGCGAAAGCCCGACAGGGCAAAGCAGTCGCTGGATCAACCAAGTACCGTTAGAAGGCTCCATCGGCAGCCCCGCAAGTC
TCGCCCAAGCATGTTCGAGCTGTGCGTGCAATCCGAATGGCGAACGACAGCGAAATTTCGGGATCAGGCTCGGAGTCCTGAGGATTCGACCTGGATCAGG
TTTGATTCCAATTCTATCTCGCCGCCGCCGTAGATCACCGGAAGCAGGAAGATCAATCCCAACCCCGTCGTGATGCTCAAGGATCACCGAGCAGCACGGT
TCAGCCATCCCGCCCTCGAAACGAAGATCGTGTGGAAAAATGTTCCCACTGCGGGTCCACGGGGCACTCCGATCTTGGGTGCTGGAAACGTTTGACTTGT
CAGAAGAGTGGCAGAAGGGGCCATCCTGGGGATCATTGCTTGTACGTCTGCCGAGCGTGCGGTGAAGTTCACGAAGCCGGAGAATGCCCGATGGAAGAGT
TTTACAACTTGATCCGCCAATGGTACGATCCCACGCGCCACGCCGGGATGTTCCCCTCGAAGGCGGAGAAGATGTTAAACTAGAACGCTCGTCAGGTTTG
ATACGAGTCGAGCGTTCTAAGTTCTGCATATTTGTATACGTGGACAGGCAAGCAAAGTCGAAGGTCAGTTCTCCGAAGGGTACTATCAACAATACAGGTG
GAATTCATAAGATATGTACCTTCACGATCGCGAGCCTGCGGACGGATGCGTATGCGCGATCGGACGTTGGGATGCAGCTAGACTTGGCTGATGGCAAGAC
ACGTGGATACTGGAAGGATCATGTTCCGGATACGAAGCCTGGAGAGCTCAAGGCCGTGAACTCGTTGACGAGGGCCCCACCGTGTCTCGGCTGGGATCTC
AGAACGGGTGAATCGCGAGGGTACTGGAAATACTACTCACCCGACAAGCGGTTCAAGCAAGCAAAGATCACAGGGAAGATTAACAACTCGAAGGCAACAA
TACTCTTCGACTCTGGCGCAGAAGTCTCAATTGGGGACACCACCTTTTCTCGAAAGATTGGCTGTATCATAGACGAAAGGGAGAGTGTTCGAATCGGAGA
GAACGTGTACTCGACTTTGGGATGCACCACGATCACGGTCACGCTCGCTGGGTATATGGTCTACTTCTTCGACGCTTGGGTCGGCCCCTCGGCTGGTCAG
AATGCGATCTTCGGCATGGATTTCATAGTAGTCCCCGCCGGGATCCGTCTAGATCTGGCGGGTGGAACGATGTGTCTGGCCGACGAGGTCCGAATCCAGC
TGTCGGGTCGGCGTTCGCCGTATGGCCGAAG