Description :
From Genome Similarity Track
Location :
Scaffold_32:68556- 70268
Transcript NameFunction/comments
Phyci_27266ATP-binding Cassette (ABC) Superfamily

Sequence
1712 bases(100 bases per row)
tccattagcgtcgtcttaccagcacccgaggatcccatgagtgcagtgatggagccggggacagcgtagccgttaatacccttaagcaactcaagctgct
ccttcgggttgtgcgggtcagggacccagtagtgcaggtcttggaatgcgactgtgacgggggtgaagttcttTTCGCGGTCACCGACAGGAAGATCGAG
GACAACCTCACCGTCCTTGCCTTTGGGGGTTTTGATGAGCGTGTAGGAATCATCTTCGACCATCTTTTCAGAGACGTCAacattttcaggagcttcgtag
cgaaggaactccagtgccagaaacgagagcaacatgaagaccacgtagatgacaatcgtgtagatgataccgtaggcgacccactccttccccgtctcga
tgccaaagagacccaagtagtactctcccatggtaagcccattatactgggagcagtagtcgataccgtcataaacgcacacgtcaaagctgttcgagcg
gtactggttgatagcgagggctcgcagactccagctcatggggctgatccagtgcgcccagatcaggtagtccgggatttggctcttcgtcacgacaaaa
cccgcgaagatgatgaagatcagggtggagaccatacccagaggcgtcacaacgttggtgttggggccaacagcagacaggaagaagaaccacattccca
tcgctaggttcatcaggaacagcacgaccacgaaaatgatgaacttggcagcgttcgcctcgaaaccacagacccagtagatcagcgtaccgaaaatgag
cgactcggcgatggccaacgggatctgacttgccgacgtggccagcacgtacgacgccgtgcggaaaaagttggcgccacgttgcttgtagaagatgtca
cgctccgccatgtacgtggggatctgggacgactgacccattgacaggaacagaatcgacgagaagatgactcccatgacgaccgacatctgcgttgggt
cgaactggtaaaacgtcgtgcagtacagcaaccccatcacgatgatcatcgtcaatcggcccaagacgaacggcttgttgcggtacgtgatcatgagctg
gcggcgcagcaacgtcaaagtgctttccacgaacgactggtggaacacgggcatcggcttcatgttttcgctggcattttgcagcaactccggggcgtac
ggggcgtccaggtcacgcagcatgtcctggtgaatatccgaccgcttgaacatgtcggcaaaatcgctggcgcggcgaggctgcttggtcgcaaaattgg
gcacctcatagcgactctgctcagcagtgccgaggtccagcaggtagtcagcaatgtcacgctcaggcgggcaaaagaagcccaggccatcgaagtagtc
ttgaacgcggtcgcaggggccgtggtacatgagctcaccctcgttcaggatcatgacgtcgtcgaacagcgaaaacacctctggggaaggctggagcagc
gcgatcaccacgttcttgtgcagagtgtgcgcgacactgcgctgggtgttgatgatatcgtaggtggcggcactgtcgaggcccgtgctgatctcgtcca
tgagcgacacgtacttcatgccgaactccatttcgccagtcgtgacgcgtttgcgttcaccacctgaaataccgcggagcatggcgtcgccgacgatggt
gtcctggcagtt