Description :
From Genome Similarity Track
Location :
Scaffold_836:6855- 10004
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_836-fgenesh-gene-0.1HECT E3 ubiquitin ligase

Sequence
3149 bases(100 bases per row)
TGCTCCAGGACGACTCGATCGACTTTGAAGGCGTGCTCTCCATGACGTTCCGCAACAAGAAGCGCTGGTTCCTCAAGAAGGTCAGTGCCATCGCCGTGCC
TTACACCGAGTCCATGTTCCGCATCGACGTGCGCCGTGGCCACGTGCTGGAGGACTCGATGCTGCAGCTGGGAGGGTCGATGGAGCCCTCGCGATTAACT
GAGCACCTGAATATCGCGTTCCTCGGCGAGCCCGCGCTCGACGCCGGCGGGGTATTGCGTGAGTGGTTCGGCTTGCTGTGCACGGAGCTGTTCAGCTCCG
AGACGGGGCTCTTCACGACCACCCACGCCGAGAACCTGAGCTACTGGATCAAGCCGACGTCGGGAGAGGTGCAGTCGAACCACCTCGAGTACTTCCGGTT
CGTTGGTCGGCTGTTCGGTAAGGCCATCATCGAGGGTCTCGTGTTCGAAGCGCATATGGCGCTGCCGCTTCTCAAGCATTTCCTTGGCGTCCCCATCACG
TTCTCCGACCTCGAGTTCTTGGACGAGGAGCTGCACAAGCACCTGTGCTGGATGCGCGACAACAGCAACGTCGACGCGCTGTGTGTGACGTTCAGCGTGC
AGGACGACGAAGGCGGCGAAACGATCGAGCTCAAGCCGGGCGGCGCCGAGATTGACGTGACGGATGAGAACAAGATGGAATACCTGGCGCTCATGCTGCG
GCACCGCATGCTCGGCTCGGTCGCGGACCAGCTGAGCGCCATGCTGACGGGTCTCTACGAGATCGTCCCCAAGTCACTGCTCACGATCTTCGACTATCAG
GAGCTGGACTTCTTCCTGTGCGGACTCCCGAGCATCAACGTGAAGGACTGGAAGGCCAACTCCAAGGTTCGCCACCTATGCGCGCAGGACGACTTGAAGA
GCATCGAGCGCGAGCTGCAGGTCGTCAGGTGGTTCTGGGAGGTCGTCACGTCCTTCTCGGACGAGGAGCGCGCGCGGCTGCTGCAGTTCGCGACCGGCTC
GACGCGCGTCCCCGTCGAGGGGTTCAAGGCGCTCACGAGTGCGAGCGGCTTCGTGCACCCGTTCACGCTGCAGGTTGTGAATCGCGGTCAGCCGCCATTG
GGTCTCTGCCCGCGCGCGCACACGTGCTTCAACCGTGTCGATCTGCCGCTCTACGAATCCAAGGAGGAGCTCACAATGTACCTGACCCTGGTGCGTCCAT
GTCCCTATGAGCTGATGGGGAGGTGTTGCTGATTGATACTGATGTGTTGTCTGCGCGGAAAACAGGTGATTCAAATGGAGATCACGGGCTTTGGGTTCGA
GTGAAGACGTGGCGGCGAGGTGCGTACCGATGAGCTCGAACTTGCTGTACGAACGAAGCCCCGGCTGGCATGGATGTGCAGGCGCAACTGAAAACAAATC
GTAAAATATGAAAGTGGATTTGAAATGTGATGCACCATGGATCAAGCGCTCATGGCAAGGATGTTTGTCGCTAAGTTTGGTACCGGCTCGACTGTTCAGG
ACAGCATCTCTTCCTCTGTGGAGATGAAGGACAAAACCGGCCATGGTAAGAAGAAGCACCGACGCCGCGGACACGGCACAGGCGAGGCTCAGAGCGAGCA
CGCGGCCTCCGAATGTGCCAACGAAGCCACATGCGAGCTGTGCACGACCTCGCCTTCGAGTGCGCGCACGCATGGAACTGCGCATTCGTCGGCGACAGCA
TCACCCGACAAGTTCCGGTCGCCAAGACGCGAAGTGCCGGATGCGTCGGTCGTGACCGTCTTCTACTGCCAGAACACGCGGCTTTACGGACAGCTCCACC
GCCAGTTGCAGTCGTCGGGCAACTCCGAGTTCACCGAAGAGAGCGTGAGTGCAATCGGCAGCCAGGTGGTTGCCGCGGTACAGGACATGATGGCCATGTC
CGGGTGCAGTCGCGGCGGAAAAGCTGCCCGTCCTGGCGCCAACCCGTTCGTCATGCTGCTCTCCATCCTGATCCCGACACTGCGCAAGGTCCTCGCGTGG
ACGTGGACGATGCGCAGCGTTTGGTACGGCGCCACCTACCCGCTGTCGCCGTATCAGCACTGTCCCGACTTCGCGAACAGCACTGCAAGGAGCAACGCAG
CTTCGAACACTGGCGGCAATAGGACAGTCGTAGGCACACCGGTAGTGTGGGCTATGATCGCGCAGCACGACCTCTTGACCAGGTTGACAACTACGTTTGC
AGTCGTCTCGCGCGTGATCGAGCGAAGCGAGGAAGAATCGGACGGCCAACAGAGCCACCACTCCGACTCGTTGTCAACTGCGTCGACCAGCACTGCACCA
CACGCTGGCAGTGCAGCCGACAGGCACCGGATTCCGCAGGTTCACCACATCGCCGTCGAGTTCGAAGATGTGTACGCTGAGTACCGTATCTGTCTCGCTG
AGCTCACCGAGTGCCTCGTGGACAATGTGGAGACGGTGCGAGGCTCGAGTTCTGACTGATGATATACATCGCCTTGTGGATTTCTCACCGGCGTGCCATA
CTCGCACAGATCGCGAATCAACTCGGCAAGACACAGAAAGACGCACCAAAACCCGTAGGATCTGTGGTGAGAAGCCTTGAGTGCAGCGATGCTGGTTTTA
CTGCATCTGACGATCCGCGCTTGATTGTGGCCGACTCAGAGCGAGTTCATGGAGCTACTCGTACAACAAGTGCTCGATCCGATCGCGAAGCGCATGACCG
CTGCACCGTCTCCGTCGCGGGTATACCTCCTCCCTCGTTTGCTCGACAGGTGCATTTCATCCACGATCGAGTACGTGTCACCCTCATCATGAAACTTGAA
GCAACGTGCCATAATGTTCCCTTTTCCATTTGGTAGCGAGTACATCTTGCGGCGCAGTACGAGCGACACCATCGTGTCGCAGCTCGAGAAGGCCATCATG
TTCTTGCGCACGTGGAGTCTCAAGGCCGAGACGGAGTATAATGCGCGTGTCCGCGCGTTGGCGGCGAGCGACAATCCCAGTGCAGGCATCCACGCACTCA
AGTCCAATAGCGGCAAGACATTGCGCAGCGACCCCGGCCTCTTTCGAACTCCGTCGATGTCGAGTCTCGCGCGAAGTGGCAATGGCGGTGGTCGATCCCA
CCCCGCCGACGCAANNNNNNNNNNNNNNNCCGGCGCATCGACTTTCGAG