Description :
From Genome Similarity Track
Location :
Scaffold_6:685449- 694183
Sequence
8734 bases(100 bases per row)
TCCTGTAGATTCGTCTTGTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCTTCATCCTCC
CATCGACATGACCAACTCACATCCATGGGTCCCTTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAA
ATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCGG
TATCTAGTTCGTTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTT
CGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTAACCAACTTCAGCTTGGATACGTGTACTACAGG
GAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTG
CGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGAT
CCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTTTTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTT
CTTGGTGCTGCATACTGGGATGGCCGCTTCCAGGGCGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGAAAATCACCCCGGATCCTGTCTTGGGCG
GTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCTCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCA
TGCGCCCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAA
GCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCACCAAATCTTCGGAAAACACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCA
CTAGCTTTGGCAATCACATATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGAATATGATCCATGG
CTATGATCTGGAAAGGGTAAGTCGCTCGGACATTCCCAGGTGACTCCCCTTCGATCGTAGGTCTGCCTTTGCCTGTCTCACAATCCACACATTCCCCGAC
ATATCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCG
TGATCGTGGTGTAGGACATCCTGTTGTAAGGTTTACGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGA
AGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAACGCTGTAGGATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTT
CTTTAGTCCCAGGATCCACGCTTCCTCATTCTGTGCTTTGAGGATCCGCTCGATGTGGACTCTCTTCACAAATGTTTCCTCGAGGATCGGGGGGCTGGAT
CCAATCCTTCCTCTGGATCTAGTGACAGCCATCACCTGGACTGTCCTTTTCCTGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGAT
CCTGATACTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAGTCTCGCTTGACATG
CACCAACTCGTGATTCATCCAACCGCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGACCGGGGCCTTGCAATCAATCTCACCTCGCACCTGT
CTAATCACCAAATTTGAATTCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCTGCTTCGT
TGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACGGTAAGTGTACGCCCCGCCTCCGCGTCGTACGCGA
GAGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGTCTTTCTTAGGAGCGACCCT
AGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACTTTTCACAATCTTCAGCGTC
CAAGGCGAGAGTAAAGCTGCCCACTCTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGG
ATCTTCCTACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGT
CCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTATTAAAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATAACCGTAGGTTGA
CGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTT
CCATGTTCAGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATTCAGCTCCGGTTTTAGGTCCTCTTCTGACGTCGTACC
ACTTGGATCCCTTCGTGGATCCGGCATCTCCCGGGCCAGAGCTTGTTGGATTTTCATTCGGACGGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTC
AATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTG
GGTAGGACAAATCGACTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCTTGGAAACTCGATGGGCTTAGTATCCACCTTGCGCATCCCCCAAT
AGCTCTTTACCACACTTGAAAGAGAGATTCCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCCGCAAGCTGATTCCCACGATTTCCCCGGGAT
TTAGATGGCGGCGATGTATATCTGGCTTCCAACACGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATCGATTAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCC
ACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTA
CTTTATCCAGATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCCGTTAACCAGCCGGTAATCAATGCACAGACGTAT
ATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCC
GATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGGCATCGATGTCACATTTGACTCCGCGGGCAGCGG
GCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGAATCACTTCAGCAGGTTCATTCGCCCCTGAATCCAC
TTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCA
TGGTAACAAACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGGCAGTCCTTTTGTCTTCGGGGAAT
CAGGTACCCTGGTATCAGGGAAACCAACAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGCCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGA
TAAGGATCAAGGCACTTTATCCAATGGAAAGCTTGGATCCACTTGAGGATCAGCGGGATCCGGCTGATCGGCTTTAACCCTCTGCAATCCTTCATCCACC
GACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCGGCGTGGATCCAACCTCCATTGCTTGGATCTCGACCCGTCGATCCCTCTGCAGGATCTT
TCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTAC
ACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCAT
AATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCG
AGTGACCCACAGTTTCTCATGTTCCACCCACTTAAGGCCGGTCTGAAAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGAT
CATCATCTTCACTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCA
GCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCT
TAATTCGCGTTCTCCCGTTCGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAA
GGCGGTATCCAGTATAGACACTTCGGGCACCTACTATTCTAGGGAGTAAGGATGCCTTTTTCATTTGTTTGATCTTGCTCCCTTACCTTTGGCCTGGTCT
GAAACTACCTTTCTTGGGGGCATGGTAACTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCAGGGAAACAAAG
TGTCCCATCCGCTAGATCATACTCACTCCGGCCGGTACCATTAATCCATCCCGAGATGGCGTCTGACCAGCGAGATCTCCAACCCGAGATGTCAAACCAA
TACACCAAACACCTGCCAGCGTGATCTGATCCGC