Description :
From Genome Similarity Track
Location :
Scaffold_1:685029- 687422
Sequence
2393 bases(100 bases per row)
TGGTCATTACAGCTATTGAGAACGGTTTTCCAGCAGACAAAGAGAACAAACTACGGGCTATTGTGTATATGTATGATGTGTGGAGGATCCGGCTTGGACC
CGACCCACCTGCGAAAGTCCCGCCATTGAAAATACGACTGAAGAAGGGTGCTACGCCATTTCGGTGTAAACCGAGAGTGTACCCGCCGCACATACGGAAA
CTTCTGCATGAGTTTAACGATGATTTGGTCCGTCTCGGATGGGTATTCGAGAATGGCTTAAGTCGGTGGGCGTGCCCTGCTTTACCGATTAAGAAGCCAG
GCAAGGACGAGTTCCGCCAAACCAGTGACTATCGACCCGTTAATGCAGAAACGGAGCCAATTGCGGGTTTCATGTCAATTCTTCAAGTAATAACAGAGCA
CGTTCGTGGAATGGCTTTCTTTGGTCTTTTCGATTTCATCAAAGAGTTCTGGCAGTTGCCTCTCGCTAAAGCAAGCCAAGAGATCCTGAGCTACATGACG
GATGCCAAAGTCTACACACCTACGCGCGTTCCGCAAGGTTGCAGTGATGCAGCCCTGCATTTTCAGAGGACAATGGAACACTGTTTCGCTAAACTACTTT
ACAAGCACTTGCTTGTGTGGATTGACAATTTATTACTGTATGCAGAGGACGTAGATTCGTACCTGGAGAAACTTAGGGAATTGTTCTCGCTGATGAATGA
GTTCGGACTTAAACTGAGTGCAGCCAAGTCCTCTCTTTTCCAGCGTTCTGTCAAGTGGTGCGGCAAGATTATTGACGGCGAAGGCGTTCGCCATGACCCT
GAGCGAATCGCGGCACTGCGTGCCATGCCATTACCGTCTACTGCCGGAGATTTGCAGCAGTTCCTGTGTGCGTGCAATTGGATGCGCGACAGTCTCGTAG
ACTATGCAGGCAATGTGAAAGCTTTGCAGACTCGTCTTGATTTGACATTGGGAAACGGAAAACGGACTAAGAGGGTTGCTGCTCGAAAACCAGTCAGTTT
TACTGAGGAAGAAACGACTGCTTTTGATAAAGTCAAAATGTGCCTCGCCGATGCTGCAATGTTGGCACATCCAAGTCCAGACGGAGTACTTTCAGTGTTC
ACCGATGCTTCCGATGAAGCGTGGAGTGTGATAGTGACTGACGTGGAGACATGGAGAGGCGACAGACTTGTTTGGGAGCAAATCATCGACTTCTTCACTG
TCTGAGTGGTACATTTACTGGATCGCAAGCTAACTGGAGCGTTATTGAGAAGGAGGCTTTTGCCATTGTGGTAGCATGCGACAAGCTGCCACACCTCCTT
CTCCGCCCGCGTGGTTTTCGACTATATTGTGACCACAAAAACCTTATTCACGTGTTCGCTCCGAGCGACACTGTGAAGAAACATATCCGTGGCAAATTAC
TGAGGTGGGCAATGCGTCTTGGTGAATTTCGCTACGACATCTTCCACATCGCAGGGGAGGACAACGTATGGGCTGATATGGTAACTCGGTGGGCTCGACC
ACAAATTCCCTTTGTATACGCAAAGTTCAAACCCGTGGACAACAGCAACACGATCGTCTATCACTACGGCCACTCGACGCCGAAGGCTTTGTATGGCCCG
ACCTAGATTCCATTTTAGATGCCCAACGCAAACTCGGGGACAAGTCTGAGACGCAGCGCCTACAGGAAGGTAGTGACGGGATTCAACGCAAGGACAATCG
ACTGTACATTCCAACGGAAGCCTCAAATCTGCTCCGCCGCTTGTGCATCATCGCACACTGCGGGCCCCAGGGACATCGAGGCCGGGATGCTATGCTGGCA
CACCTTGGTCGAATTTTTTACGTGCCTTCCCTTCGACAATGCGTGGACAAGTTTCTGGCAAGCTGCCTCCTGTGCCATCATGTAAAAGGGGGGAAGGTGG
TGCCAAGGCCCTGGAGTTAAACCTACCGATGCAGTGAGAGAAATCAAGCGCTACACTGGGATTTTCTCTACCTTGGTGAAACCTACGGTGATCTGCAATA
TCTACTGGTGCTCAAAGACGATGCTAGTCACTACTGCGAGCTTGTGAATTGTGAGACCCCAACAAGTACAGTGGCGGCTGATGCTATCATGGATTGGCAC
AGCAGGTTTGGAGTGCCTAAAGACTGGATTAGTGATCAAGGGACTCATTTCAAGAATGAAGTAGTCGACGAGCTGTGCAATAGGTTGTAGTGCAAGCAAA
TCTTTTCGCCGACCTACAGTCCGTGGATTAACGGGTCTGTGGAACGGGTGAATCGAGATATTCTGAAAGTCCTGCGGGTACTTTTTCTGGACTACAAACT
TAACCACAGGGACTGGCCAAGGCTAATTCCTATTGTACAAGCAAATCTCAATCACACTGCCGTACCGTCGTTGGCGGGCAAGACACCGGGCGA