Description :
From Genome Similarity Track
Location :
Scaffold_28:685- 7732
Transcript NameFunction/comments
Phypl_g1134hypothetical protein PHYSODRAFT_325501
Phypl_g1135nuclear pore complex protein Nup93-like protein
Phypl_g1136conserved hypothetical protein
Phypl_g1137conserved hypothetical protein

Sequence
7047 bases(100 bases per row)
CGCCGTACGGGATATACTTCCGTTGGCCCTTCCAGATGCGGAGGTCATCCTTCCACGACTTGGGCATCGAGTGGAANcgcgttctcgagcttcagGAAGA
ACTCGGTCAGATCTGAGCCTTCCTGGTACTTGAGCTCCATCAAGTAGTGCTGGATGAAATACGGATCGCCGTGAAAAGCAGCGCCCTCGTACTTCTGGCA
GATGAAGTTGAATATCTCGTAGGAGGTCATGAGGTTCTTGACCAGTCGAACGTGCGTGTTCTCCATGGTTTTCATCAGGAACGCTGTTATCTTCGCTTCC
TGGCGGCGNGCGTGTTGTCCATGGTTTTCATCAGGAACGCTTTTGTCTTCGCTtcctggcggcggcgctcacgctGGCTCAATGGCtggggcttcttctt
cacccgCAATCTCCCCGCTGAGAACGCCCTCCTACCGCTGGTGGATGTGGAGCAGCATTTGACGTTATCACCGAAGTGGTAACGCCAAACACCAGGCTAA
GAAACGACGTGGGTCCTGCCGTACGTCACGCAAGCACCACTCACGGTCCCCAAGAACCACTAAAATTTAAACTGTATAAAAATATACCCTTCTATATACG
ATAGTAGTTGGTATTATCATGTTGAGGAGGAATGAAGCCTCATGCGGAAACCAGATTGTTACAATCCTCACAATCATTGTGAGGTTGCTGTTGAACGTTT
TCTTTCGCATTTAATACGCGTAAAATTTGTGATTTCAAGAACCACCCAGTACAGTATTCCCTCCGCCTACTATAATAGAATTATGAAAGTAATTTAAAGT
AGAAGTATTAAGATCGGGTGCATGTATTGATCATGAGCTCGTTTGGTTGTCATACACCCATGCGAACTCAAAGCTAGAGTCAGCGTGCCCCCCTTCACAG
AAATGTGTCTATTTTCATATTATTTTCTTTCCTCATTCATGCAGTTCTCGATAATTGCATTTTGTTTATCTCTTGGTAGGATGATCTTTCGGGTCTTTGC
AtgagtacatgtacgttcGATCTGTTGAGAATTCCTACAGCACTTATGTAGTAGTACGATATAGATATTTCTTGATATTCGGCAATTCAGTAGACAGAAG
CCACCAGAGCATCAGTACATGACTGAAGGCTTCTGTCTGCAGGGCTTCAACTTTGCGGGTATtatgtgcaccacatcacTAACCTTCTCCGCAGCATGCC
CACCTATCATCCCGCATCCCGCGTCCTCCATTGCTTTTGGGCGCGCAATAAGGAGTTCCGTCGCCCCCTCTCGATCCCCGCTCGCCATGGCCTCCAACGA
CGTGGACTTCCGGGCGCTGTACcagagctcgctcaagcTGACGACGTCCCTCGGGGAGCTGGGCATCCCCCGGCTGGAGAAGTgtctggagcagctggac
gacgcgtcgcgctcgctcaaCGCCCAGGCCCCCAGCGCCACTGGCAGCCGCAAGCGCCCGGCCGCCGCGGGTGCGGACAAGGCCAACttcctgctggcgg
ccaagggcatcgacgccgagaagctcagcaaggagctgcagcagttcgagaTCGCGCCCGAGTTCGAGCCCGAGACGCCTCTGGGCGAGACGGACCTGGA
GGGGTATCTGGCCCACCACCACGAGATGATCGTGCTCACGGCCATCGAGGACGTCAACCGCCGCACGGTGGAGGCCACGCACGACCGCATGAACCGCGCC
ATgatcgacgacttcgaggatgccaagcagcgcctgctggaggacctgggcggcgccaagcagctcggcatCCGCAACTACCcgagcgtgctggaggcgg
acgaggcggccggcagcatcttctcctctgctgctcgcgagaagcgccaggcgctggagcccgCGTCCGGCCTCGGACTCAGCGGCACGTTCTTCGCCGG
CCAGCCGCGCTTCCAGTctaccaccaccagctcggcctTCGGAGCGCCATCGCTGCATATgtcgcagctgcaggtggagaacGCTATgacggaggagatg
aagcagTACTACGCGGTcatcaaggagctcaacAGCAGCCGCGTGCCCACCACGCGCAGCCAGTTTGAACTCGCACGCCACTTCCGGACCATGTGCTCCT
CGAACGTGTCGGTGTCGGTGACCGGATCCAAGTGGGAAGCTGTGCTCAAGTGCTGGCAGCTCGTGAATGACGTGCTGGcaggtggagacgctgcccAGCC
CAACGGGCCAAAGCTGGCGGAGCGTGAATTTGCGGCTACGAGACAGGGAAGTGACGAGTCACAGTGCACACTGGTCCAGCACCGCTTTGCGTTTGGCGCG
CGTGTCTTCCTGGAGAACCAGTTCCGTGCCTTCGTGCAAGAGACTGTGCAGAAGAACAACCTTGCCACTGGTGGCATTCCGGACCTGGTGTCTACTATTC
GCGCGTTCGTGAAGCACCTGCACAGCTCGCGCTACGCTGCCAAcggaagcggcagcagtacTGACGTGGACAATATCTGGGCCATTATCTACTACTGCCT
CCGCTGTGGTGGTGACCAGGAAGCTGCGAATCTCGTGACTAACCTGTCAAGCTCGGGTGATGATTCCACCATTGACGCTGCCGTGCTCTGTGCGTTGAAA
TACCGCGCACACCAAAAGAGTTTGTATGCGAACCGCAGCGCTAACCCGCTGAATGCTTTTTCGAAGCAGTTCCCTGCCGAGTTTGAGCGCTTGGTGGGCC
GCTACCACCGCTTggtgagctcctcgatcgACGCTGTCTCTGTCGTGAACCCGTTTGAACGCTGCGTTGTGAACCTGCTGTGCTTCAGCAACGTCAACGC
TAACGAGCAGCGCATCTCGACAACTGTGGAGGACTATCTGTGGCAGCGTCTTTGCTTTAtccagcgcgctgcagctACTAACTCTGCTCCGGATAGCACT
TACACAATCGCCAAGCTATCTCAGACTATGCAGCGATTTGGCCCAACCCATTTTGAGGGTGGAGCGCAGCCTGGTGGAGGTAACTTCTCAGCATTTTTGT
ACTTTGAGATTCTGCTTATCACGCAGGAGTTCGAGAAGGCAATCAAATATCTGGCGTCCAAGggcttcctgctggaagcggtgCACTTCGCGATCACACT
GAACCACTACGGTTTGTTGGAGTGCACATCGTTCTCGATgggagaggaagacgaaACAACAGTCGACCTGGTACGCCTTGTCCGCCAATATATTCACGGT
TTCCAGCGAGCCAACGCCGCGGAGGCTGCAGACTACGTGGCCTGCATCTCGGATTTGACAGCCAAGAAGGAGTTGcttgcggagctgctgcttgataCAC
GCAagttcgacgtgctggccggaTTCACAAACAACACAGACGGCTCGCGCACTCGCGGACTGTACGACCatctgctcaaggacgagccTGAAGATGAGGT
CAAGGAGCTGATTCTCTCAGCTGCGCGCAAGGCTGAGGCTCGCGGTCGCCCGCATGATGCGTTCGCGCTGTTGAAGAGCGCCGGTGATATTGAAGGTGTT
ATTGCTCTGCTCAACTCCCAACTCAGCTCAGCTTTGTCGGCCACACGGCCAGAGCGTGAGGAATGGTTCCGCGAGGCCAAGGAGTTTGCCGAGAAATGGA
TGCGCTTCCCGTGGGTCCAGACTGTTGCCAACCGGCATGCACGCACGGCCGCCATAGCCTTCCAGACACTCCTGAACATCAGCATCTTCCTCGAGATCTT
CGAGAAACAGCAGTACGAGGATGCTATCGGGTTTGTCGATGAACTGGAGGTTGTACCGACGCAGAACTCGAGCAACCTGTCGCTCTGCGTGGATCGCTTT
CTTGCCTTCGATGAGAGTGTCCGACAGAACTTCCAcattctgctgcttgggtACATGGAGTGTCTTGTGCGCGATGCAGACCGCCTGAAGACTCAGGTCT
CTGGAGAAGTCCGGCGTGCCAGCGTCTCTGCTCTGCGCGAAAAGGCCGAACTCCTCGTCACATTTGCCGGCATGATCAAGTTCCGTCTACCATCGGGCAC
CAACGAGCGGCTGAACCGCTTGGAGGCCATGATCTATTAGAATGCCAGTCGCATCCAGGAAAACAACTCGCGCGGATGCAGCAAGAGATCGGCGAGGCTT
CAATGTCAGTGATAAATGACAGGAATACAACGAACGCACTTGCGACTGCAATTTGTATTGTACTTGCCGTTCAGCTACGAATAGTGTCTTCTTCGGGCCG
CAACTACAATGTCagtctctctctctctctcctctCACTGGTCTTCCTACTTGCTACTACTTTCGGTCAAATAAATCTTGCATGCTTTTTACTTGCTGCT
CTCGTTGCGTCTCGCATGTCTGCCGCCTGCGTATCGGTCATTAAATTACCGTAGCGGCGCCTGCCGCTGGTAGAACAATCTCGTGGCATTCGACGAGAAC
TGGAACTTGCTCGGTGACGTCCTCGACAAGAACCTGGCTGACGAGCTGGGCTGCTGGATGCTGTCACCACGGCTGGTAACAAACGCAAACGACTTGCGCG
ACTcgaaggacgacgacggagctgctgctgctcgggtACCGAACGTCAAGGCGCCTGCACTGGCGAAATTGATGCTTCTGGCACTGGCGCCGCCGATCCG
GGGCTTTCtcagcacgagcgccttctcggcgctgctctctcctgctcgtcctctCTTGATGGCCGCCTTGCGTGGCGTACGGATGCGCGAGGGTCGCGTC
AATTGGCTCACATTGGCCGTAGACGGTGCGGGcagcgagctggtgaaggccgtcgaggccgccgacgacgcgaagTTGAAGTAGCTGGTAAAGGCCCctg
tcgactgctgctgtgttGCGTGggtcgagctggacgcggcgtCGCCTGGCGCGTGCTGTCGCGACGTCTTGGGGACGGGGTATCCGGGCGGGCGGGCGAG
GTCGAACTCCTCGTTCATCAGCTCTTCGCGGCTGCCgaactgctggaagaagatctCCTCCGTGTTGAGCTGCGAGGCCTTGGCGATGCGTTGGCGCAGC
TTCGTACGCGGCGTCTTGGCCGGCGTGGGCGCCTCGTCGGCCAtttccagcgcgcgcttggtgcggcggccgctgccgcccggCCCGAACGTCTTGCGGA
TGCACGCCCGCGCCTTCGCCAGCCGCGCCTCGCCCGCGGAGTCCATGGGGGACATCATGAAGAGCGCGCCGTCCTGCATCGCTGTAGTCGATGATACGAT
GAAAAGGATGAGAGAGAAAGTGACTGTATACGCAGCATCACCCGCACCGATAATGGTCTCCCGGGAAATTCAAACGTTCAAAATTTGATGTGATCGGTAT
TTCGGCAGTATTTATGTACGCGAACATACAAGCCTTACGTGGTACACATAAtgacaagttgaagtggggcCACTCGCGGAGTGAGACCCGGCGTTGAGtt
tttctccttcttctctgcAGTTGGCTGGCGTCTCTCCTGCCACTTCGAGAATCAAACGAGCAGCGCATTTACCCGTTGGAGGCTGACGAGGAATGAAGGC
GGAAACGGCGATCTCGGATCTGCTGATGAAATGCGAGGAGCAGGGCATGCAGCTGCCAGAGGTGCCAGCATCGAGCTCTGTCGGATGGTCGGTATGTTGA
ATCCTAACTAGCCCTGCACTGCACGCAGAACCCGTGGCAGGCGATGCGCGAGGCGATCACAGCGCTGCGGAACACCAAGCACCACGCGCGGGGGTATCTG
CAGATACCGAAGGCTTTTGACCAGCTCAAGAGCGAGTTCCCCAAAAGTGCTGACGGGGTGACGGCGACCAccgtggcggcgtcgcctCGTGTGGTGCGTC
GCCAGAAGCGCACGCTCATGCAGGACATGCCCAAGCGCAACCGTCGCAACATGATCCTCGATAGCTACAGCGATAGCGACGAAAGCTCTGGCGGGCAGTC
CGGGCTTGCCAATGCTTTGAGTCCtgtcgcgagcagcaagaagaagaccaagtACCCCAAGAAGAGCCGCATCCAGGAGCAAGTGGAGGCCACGCCGGCC
GAGCGCGGTGACAACCAGCCGCTCGTAGACCAACTCGTGCTGTTGGGCGAGTACGAGATgcaccacggccacgcgcagcgcggGATCTCGCGCATGCGCG
CTGCGAAGGAGATCCGGGACTCTCGAATTGTCATCACTTCGGGCGCGCAAGCGAAGCAGCTGGACCGTGTGGGTCCGGGCGTGGCGACGAAAATTGACCA
GCTCCTGAACGAAGGGCTCGCGGCTGCGCTAAGCGAGTACGATGGGGATGGCGAGGCTCTGCCGGTGACAAAGTGAGGCATTGTTTTGAGTTTTTAACCT
TTAGGTACTCTGTCCCTCCGTAAGGTTAACGAGGGGGTCAGCGACGTCAGGTTTAAGTGTAACACGGGAGTCGCAGTTAAAACATGCATTTCACGACAGT
TGAGTGACGACGCCCAGAGAAGGTTGACCTCGTCCCAGTGTGTTGCGGACTGGGTCGTTTGTCCAAGTACTGCGAGTTTTTCCGTGTTACCTACAGCTGA
ACCCAAACACATTCAGGCGTGAAGACGATGAATCTCCGCCAGGCacagcgctcgctcgctgacCTTGTCTCCAAGTGCGAGGCCGCGCATATCCAACTCC
CAAAGGTTTGTGAAGAAATGTGCCAAAACCACTTCGCTGGTATCCTCTTTTCAGACTCATGACTTGCTGTTTCTGCAAAGGACGCGTTGGAAGCTCGTGC
CGAGGCAGTGGAAGCTATCATCCACTCGTTAAAGGACGGGAAGGTAATCAACCTCCTTGCAGTCAAATGACGACAACCGACTCATTTGGACACTTAAGAA
CTTACATTGGTTGTCCTGGAAGGCCAACTTGAGCGATGCGCaagatgagctccagcaaaagtacggccttgagcttgtgtGGAAGCAGCACATGGAGAAT
GAAGAAGCCAAGcgtcagcgccgtcgccaatCCCAACAGACAAAAGGGGGCAACCGCGCAAAGGACCCACGACTCTCGAATCTCGGGTTCCTACCAGAAG
TTCCACCACTGAAAGACCAAAGCGAGACGGGGGCACAGGGTCACAAG