Description :
From Genome Similarity Track
Location :
Scaffold_2400:685- 2633
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2400-fgenesh-gene-0.0HECT ubiquitin ligase

Sequence
1948 bases(100 bases per row)
TACGCAGTCGTGAATCCGTACAAGTCCGTGTCGAGAATCGCCAGCAGCATCGTTCTCAGCTCGTCCTTCGAGCGATACAGCGGCACATCCAAACGGTTGA
AGCATGCGTGACTCGAGATGTACTGTGTCGAGTAGTACGACACTGCCTTGAGCGTGAACGGACACAAGCGACCATCGTAGCTCGTCAGCCCGGCAAAGCC
ACCCAGAGGGACACGAGACGACCCAGTCGCAAAGAGCAGCAGGCGCCGACGGTACTCATTCGGCATCTCGGCCACAACCTCCCAGAACCACGTGAGTACA
TCGTTCCACTTGAGATTGGTGGCTTGGGAAACGGTGTGCGCCTTCCAGTCCTCGACGTCGATCTCTTGGGTGCCGCACAACAAATAGTCGAACTCCTCGG
TATCAAACAGCATGAGCAGCTCCTGCGGGATCACCTCGTACAGTCCCTTGAGGAACGCGTACAACTGACTCGAGACGCTCTCAAAGAGGACATACTGGAA
CCTCTGCTCCAGATACTCAGCCTTGTTCTCGTCTGTCAGGTCAATGTTGTGTCCATCCAGCACCAAGTCGACTGTTACAAGCTCATTGCCTCGCTTTTCG
GTCACGCTGAAGTCCAGCCCCAGCGCGTCGACGCCATCATTCTCCATGATCCACAGCAGGTTCTTGTATAACTCTGGGTCGAAGAACTCCAGATCGCTGA
ACGTCACAGGGAACCCTAGGATGATCTTGATCAGAGGCAGTGACAAATGGAAACCCCAAATGCTCCCTTCCAGCAAAGCGCGTCCAATCAGTCGTCCCGC
TGCGCAGTAGTAGGTGAGATGGTCTTCTCCAAGGCAGTGCGCTGAGTTCGGATTCATGTAGTAGCTCTGCTCCGTCTTGTTCGTGCACAAGAATAGACCC
AGGGTTGGATTCAGCAGTTGCTCATTCACGAGCATGAACCACTCGCGGTACACGCCACCGGCATCTACGCCGCTCTCTTCGAGAAAGTTGATGCGAATGT
ACGAGTGAACGTCCTTCGTCGTCATGCAGCCCACGTGGTCGACGGACTCTTCCAACATGTAGTCGCGATGCACCCCGAGCTTGAGGAACGTCACCTCAGC
AGGTACGATCAGCGCCGCAGTGCTCACGACAAAGTGCACGTATTTGGTCGGGAAGTCTCTCGACGCGATCTCAACGATCTCGTTGAGCTTCGCGTGATTC
TCAATGGCATTCACAGGTAGCTTGAGGTGCGCTGCTGGGTCCACTTGAGCCGCATTGACGACCTCGACCTTGGTCATGTCGTCTTCCACAATCAGCAGCG
GCTGGAACTTGGACTGCTGGTCAGCTTTGTCGTCGTCGTCGTCGTCGTCGTCGTCGCCTTCCTGTCTGGAACCAATACTGCTTTGACTTCCATCTAGAGC
TGGAAGCCCCGCCCTGAAAACCTCCTTAGCAATAGCAGGCTCAGTGCACTGAAACACCGCCACATACCCAGGCTGTTGGGACTCTGCAGCATCACCAGAT
TCGACACTGTTTCGGTACCAAAACATGTTTCCGTCCACACCCACTCTGCGCACCCACTCCTTGCGCTTCCTGTACACCAAAATCACAGCCAAAGTAAAGA
AAATACATATCAACAAGCGTGAGTGCATGCCATTGATGGTACAACTCTTCATAGTTTACAGAATGCCACACATTCAGGACTGACGACTGACGTACCGTAC
GCGCAGCTGGCGCGCTGTTCTCCCCTGCGCCACGGTGCTTGTCGTATCGGCAGTAGTCGCAGCAGCTGAGCTGTTTGTAGTACTGGCGCCAATTATTCCA
TTCTTCTCGTTGGTTTCGCCAATATTATCGCCGCTGGCTGTTGCTGTTGGTACCAGTAGCGTCTCGCCGCAGAGACTGCAGTAGACGTAGCGCTTGAAGT
TCTCAAACTCGCAGCCTGGACACACAATGAATCCCGACTCGGCGTCTC