Description :
From Genome Similarity Track
Location :
Scaffold_51:68490- 70302
Transcript NameFunction/comments
Hyaar_Emoy2806488Non-histone chromosomal protein 6
Hyaar_Emoy2806489DNA binding protein, putative isoform 1

Sequence
1812 bases(100 bases per row)
TCACGGAGATTGCCACGCTCTTGGCCGAGAAGTGGCGCGCGCTGCCGGACAAGAAGCGCGTCAAGTACCAGAAGATGCACGAGGAGGCGAAAGTCAAGTA
CCTGCAGCAGATGGACGTTTACAACTCGAACGACGTGGCGGTGCAAGAGCCAGACGAGGTGGACGAGGACGAGGAGGATGACGAGGACGACGAATAGGCC
GAGGGAGGGTCGGCGATGTCTTCACTCGCTCGCTCTTCCTCTCTCGCACCCGCTCTCTCTGGCTGGTCAAGCTGCTGCTTGCAACTTGACTAGTGGCGAG
CTGATTGCCAGCGAGCGTGCACTGGATGCAGCACACGCGCGCTTGGCTAGTAGTCAGGAGGAAGAGAGAAGCAAGCCGACAAGCAGCGTGTCATTTGGGG
CGCTGCTATTCCCTATAGCTCGTAGTATGCTGGACACCTGGTACCCTCTTTTTATACTTTGAAGCTTTGGTAACATTTGTTGTCTGCTGGTTCCTGTCTC
AGTAGAAGGAAGGGTGACCTTCTGTCGCTCTTGTCATCACGATTGGGGAGTTCAACCGCTTCGTGCGACGGACACTCTGTCTGGATCTTGTACGAACGAG
TGTATCCACCAGAAGGCGCCTCAGCTCAGAACCGACTCCTTGTGAGCCACTTTGCATCTGACGTGGCTGGCTGTTCGAAGCCCAAACGACAGAACGGAAC
AGGATCCGTGTTACGACAAACACCTCCCGAGACAAGTCCGACAACGACTGAGCAACATGACTAGATTTTTGCTACAGATCCGTGTCTTCTTTGACGTAGG
TGGATGCACAATTGCCCCGGCCCAGCAGCTCTGGCAGCCTGCTCGACAGCAGACTGCCTGCTAATGCAGCAGCACATCGAAGTCCGGGGTCACCACAAGA
TGGCGCTCGACGTTGCCCAGAATGCTCAATTGCTTCTCGGTCGTGTTCACGGCATAGATTTCTTCACAGAAAGAGGGCGTCTGGGCCGCTGCTACATTAA
ACTGCTTGTCACCGAGCATCAGCACCATCTTGCCCGACTTGTGCACGCAAATCTAGTGGCAGCAAAGCAATGCGCAGCAACAGCGGGTTACGATCAATAT
GGGCACACAGTACAAACTACACGGCCGAGACATGACGTACCTTGCCAATATACCCGCCCGGCGCAGTCTCAACCGAGTGGTCAAACACTCCATCGTCACT
ACTAAAAAACACAGGAGGAAATAATGAGATACGGCACACAGCCTTTTGGCATATACAATGCATGTGCGTACGGAGAATCGTCCGAGCTTGTGTTCTCCTT
GGTCTTCTTCGCTTCCTGGTCGTTCACATCCTCCGCACTATCCATCGGGTCGTCTTCATCTGTTTTGGTCGTCTTGGTTACAACACTCGAAAGTGGCAAC
GTCGTCGGCATCTGAATAAAGAAGAGCGAATCATCCATCGCCACCAAGTCACCGCTCGGGTCGCAAAAGATAGCGCCAGCACCCTCCGGTTCCGGCGGTC
GCACAATCGGCAAGCTCATGGGCTCCATAACTGACTTGACTACTGGCGGCCACACGTGCTCTTCTTCTACGACCAGTATGTTGCCTCCAGGCATCTCTGC
TTCATCCAGCACACTGATACCAGTACCGCCAGCAGCTGAGTAATCGGCGTACGCCGACGTAGTGCGTGGAGCAGCTGTGCTGCCGCCCCCACCATAAGAA
GATCCACTCGAAAGCGTACCGACAAACGCTACTTTGCCACTGGGCAGAAAACCTCTTCCACGTCCACGACCTTGTCCGCGACCACCTCCCCGACCTGCTC
CTCGGCCTCCAT