Description :
From Genome Similarity Track
Location :
Scaffold_30:6849- 7893
Transcript NameFunction/comments
Physo_134092pol protein

Sequence
1044 bases(100 bases per row)
CTCGTACTGCAGGTATGGCTTCAGCCGTCCGACGTAGAACGTCGGATGGAGGCGCATACTAGACGGTATGTCCAGTGTGTAGGCGTTGCCGTGCCGTGCC
AGCACAGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTTTGAGTAGCTAACAAAACCAATG
AACCCTTCTTGAATTCATTTGTGTTGCTCCTGCCAACGTTGTCTGCGTTCAGCTTCTGTCGATCAACAGAAGCTGCAATAATAGCGTCTTGGACAAACCG
AATGACGGCTTGTCTGTGCTGCACGAAGTTGATTGCGTCCGAACTGAACTCGTTCAGCTCGTTCCAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGA
GTGCCTGTGTCCTGTATAGACCCGTTCTTCTTCTTGCTCTTGTCGGTGTCTGTGCCCTGCACAGACGCGTTCTTCGTGCGCTTGTCGGCGTCTATGCCCT
GCACAGACGCGCGGTTCTTGGCTTTACTTCGTGTCGTTGCGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGT
AGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAAGGGTGTATGCCCGGTCGAGGCATGCACCGAGTTATTGATGGCGAACTCCGCCATCGGCA
GGCACTCGCTCCAGTGTTGGAGCGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTC
CGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTAGCCAAAGGTGCGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGC
ATGCCATGGTGTTTAAACACCATGTCGACGAACAGACGTGCAGTCTGCTTTGCAGTCACTTCAGCGGGTACTGCAGCAAGATGTACCATCTTGCTGAAGC
GGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGG