Description :
From Genome Similarity Track
Location :
Scaffold_205:6847- 33398
Transcript NameFunction/comments
Phyta_totarag5557hypothetical protein PHYSODRAFT_362533
Phyta_totarag5558hypothetical protein PHYSODRAFT_247554
Phyta_totarag5559hypothetical protein PHYSODRAFT_342126
Phyta_totarag5560mitochondrial-processing peptidase subunit alpha, putative
Phyta_totarag5561hypothetical protein
Phyta_totarag5562hypothetical protein PITG_04723
Phyta_totarag5563notchless family protein

Sequence
26551 bases(100 bases per row)
TTGTTGTGCGTTCTTGCGGTTTGCTGGTTGGATTTCAGTTCTTGCGGCGTCTCGACCAATTGAAGACGTGGTTTGACGAGCAGCAAGGGACCGAGTTCAT
CGCGagctccttcctcttcctgtACGACGGCGAGGAGTCTGTACAGGACGGCAAGCCCGTGTCAGAGGCCTACGCAGCCGACATCCGCCTCATCGACTTC
ACCCACGTGACTCACCCAGCTTCTCCCAAGCGTGATGACGGTCTCCGAACAGGTATCGCTATGTTAATTCGGTGTTTCCAGACATTGCTTCGTGAGGCCC
AAGCCCAGCAGTGATTCAGATCGGTCGTCCACAAATCGTACGGATGCCGATAACCAAGAACTCTTCTTAGGCTTAAGCTTAGTCATAGAAAAAGGCTGCA
CGGATCTTCCATGTCTTCCGGGCGTTTTGATGGCAAACCGTCTGAGTCCAAATTGCACCATGTGCTGGTCGATGACTCCACATTGTCTGAAGGTCTGCAT
ATGTACAtgtcgttgaagctgtaAAAGTCGATGGAAAAAAGCCGTTTCGAAAAAAAGAATATAGAATTTACAGCGAAAAGCTCTGGACGACGTCCATTTC
CGCTTCTTCGGGATccccagccagcagctccatcgaTTGCTATTGCCAGCATGCGCCCGCAGAGCATACACGACGACAGCCCCAGCAGAGGCGACAACCA
GCGAGACGCGGGTAGCAACTACCggacggagctggagcgactACTGCACGTCTACGAGCCGGGCAACGAGGCGTCGGccgcgcagctgctggagacgtAC
GCGGGCATGGAGCACGAGCTCATCGAGTGCTATCGCCACTACTACGCGGGCAAGGCCAGCTTCCGCGTGGCTCTGGACGACAACCAGGAGGCCGGCTCGC
CGCGGGTCTCGTCCCCCGGGCCGCTGCATCTGCCCACGTCGGCCATTGGCACATATCTGCAGGCCAAGCTACAGTCGAGACGGGGCGGCGCGGCGCGGAA
CGCCAAGCTGGAAGATGTGCGCGGGCCCACCGCGGCAGACAGCCCCAGTAGAAGATGCCCCGCGGCCGTCGCgcctcgacgacgagccaCCAGCTTCACG
GCCAGACTGCAGCATGAAGCTGGCGCACGGAACAGCAGCtatgaagacgacgaggacgaggctgAGGTGCTGGCTCGACGAGCTTCCACGCCCACAGAGT
TCAGTCGGAGTAGCTCGTAGGAGGTTGATCCCAACCATTATTAGAGCAATGATGTACGTAGCGTTACCCTTGTAGTACAAGTTGTACATGCAGCATGTGC
GCCTTGCTTGGGGACTGCTGCCCCGTCCCGTCGAAGCACTTGACCCCACACCGAAAGTGTCTGAGCTTGTACAAGCAAGAGAAGGGGGAGGTGATGCTGC
TTGCAGACCTCTGCACCATGAGGACACCAAGATGTTTggaggagttgctgctgtttggtgCACAGGCATGGACCAACGAGGGTTTCAAAACAAACGTGTT
GATGTGGATAATGCTATTGCTCGATCCTTCCTTTACCTAGATCAAAACTGGTTGGGAGGAAGGCTACGTTCCCAATCCGACGGCATAAAACACTTCTCTG
CCGCTTCCTCGCCCATGAGGAAACTCCGATCCATAGCGGGTTGTTTCTATCTCTATTACAGCGGAGCAGTCAGCTCACACGACTCACTTGCGCTTGCACT
CCGATtgtcagcttcgtctcgTAGGGTGCGGCGTGCAAGAAGCAGACTCGTTAAGCAACTGCACTTTGGCATTGCTGGACTTATAacatctgcatctgct
gttgctgctgcatgctgtGCATCTGGTGCTGCGGGTACCCGTTTGCCGAGTAATACATCATGTTGGcctgctgcggcggcgccgACTGGTCACCGGACGc
ggcagcttgctgctgctgctgctgttgctgctggctgtaGTATGCGCGAgggggctgctgctgttgaccGTAGGCtgcggcggcagcggcggagTCTGCT
GCGCtaaggtggtggtggtactGTGACGACTGTGCAGAGTACGGCACGTGGTGgccaggctgctgctgctgttgctgctgctgctgttgctgctgctgct
ccttgacATCGAAATAGTCGACCCTTCCATCCGGGTGGTGCTGCGGCATCTCCGGTTTCGCCGCCCAGTGCTGCGTGTACGGGTTCTTCATGTGCTCCTG
CGCGGCGCGTGGTGCGTAAGCCTGACGCTCCGTAGCGGCGGCGGGCTTGTACATGCCGCCAGATACAGGAGGCAGAGCACCGTTGTCCACAGCCATGTAG
TGGCGAGCGGCGCCGCCAGCTTGCAGGCTAATGGGCTCGTACGATCGCTGGTCGGCGTGGATCTGCAAGTATTGGCCGGCGTTGGTCGGCCCGTCGTAGC
CCTTGTAGCGCATGTCCATctcaacgcgctgctgctgcacgtacgCAGCGCGCTGCACATCGACCTGGCCAGCAACGTGCGGGTCACGCAAATCCTTCAC
ACCCATCGCGAAAGTCGGCGTGGTAATCTGTCGCATATCCATCATGTGTTGCGGCACCCCAGCCGTAGCGAGTTGGTCCTTAGGCAGCTTGCCCTTGGCG
GCGTTCGCGTGGTACGAGCATTTGCCTTTCTTACGAGCGGGCTTGTTGCATCCGGCGTGGTCGCAgcgcttgccgccgccgtgttCGGCGCAGAAACCTC
CTCCGCGGTCATTCTTAGTGCAGTCTGGGTGCTGGCAGAACCGGCTGCCGCCGTGGCCGGCGCAGAAGCCGCCACGCTGGGCGCCCTTGTTGCACCCCTC
CTTCTCGCAACGCTGGCCACCGCCGTGCGCACGGCAAAAGCCTCCACCCTGGCTACTCTTGGTGCAACCAGGACTTTGGCAACGGAGACCACCGCCGTGA
GCCTTGCAGAGACCGTTGGACTGGGAAGCCTTGGTGCAGCCAGGCTGCgtgcagcgcttgccgccACCGTGACGGATACAGAGCCCCTGGCCCTGACTGC
TGCGTTCACAGCCGTCGACCATGCAGCGACGGCCACCTCCGTGGGCTTTGCAGAGACCCTTGGAGCGCACGCGCTTGGTGCAGCCAGGCATGGTACAGAG
GCGGTTGGACTTGAGCGACTCGTTGCGGGCCGACGTGGGCGACGTCTTAGCCcccgaagaggaggaagacgaagcttGGCTCTGGACCTTGGCGACGCTG
GTGGGGGACGCGCTGGCGGACGAGGCTTCGGTCTTGGGCCGCATGTTGGTGGAGCCAACAGGATCCTTGGTCTGCGTGGGCGGGGCCGACGTGGTCGCGG
ACTTAGAGCCGCCTGACGCGGCCGAACCGCTGACGGCGGCCATGGAGTTGTGCACGGCCTGGTCGTGCAGCGCGCGCTCCTGCGCGTACTGCTGGTAGGC
TGCCGTGTCGTAGTTGAAGGCCTGCGCGGCCGAAGCGTCGAGCGCGGCGGCGTTGGGATCTTGCGGCTGCATGACGACAGTGCTGGATGTGGACTGGGAC
GCCGAGGACGCAGACGCGGAGGCCATAAAACTAACTGCTCCGACTCCGGCAGAAAAAATACTTGGGGCTCTTTGTTGGCGGAGACGGGCAccacgaagag
gacgaagacgaagacggagcGAGGAGTACCAACGGCCTGGTAGGAAACACAATGGTAAGCGCAGGACGACCACTCACTCCGAGGAGCCTCCCCCCTCGCT
CCTGCGGACAAGACGCACGAGCTATGCACAGATGGGAAAGAAGGGGCAGCCGCGGCGGCTAGGGGAGCATTTGCTTTTTAAATCGCGTCCAATTGTGTGC
GAGCActcaaaaacaaaaactgGCTGTTCTCTTGAGACACGTGTCAACTGATACCAGTGTGGCAGTTATAATAGTATCCCCGGGCGGTGGCGCCAAGACA
ACAGTAACAAATAGCCGTCCAAAGATAGCTGTGGCAGCGCCAGCCTCGCCAATATTATATCTAAGGTAACGTAAAGCAACCAGGAGCCAACGCGTGCCCA
GCTAGTCTGTCACCGTCCAATCACACGGTGACGATGCGGTCGCAAAGGCACAACTGTGCGAGCTCAGACGGCGCAGATCCCTTCGCATGTCCCAAGCCCA
TCTTCAGAACTTTTTCTGGTCTGGTGATGCGTGACAAGAGAGCAGGCGAGAGATGAACCAATCGTAGGCCTTCGTGCGCGTTTGGCGCGCTGTGGTTGGC
GGAATTCATACCTTGTGCCCCTCACAGGGGTATGTATTTTTGCGGGTTAGTTGCACTCACTAAAATCAGCCAATCATGTTAAATCTGGCAGAGTATGCAT
TGTAGCCAACGCGTCGTTCAGTCGCAGATGCAACAAACCGGATCTGCTCATCGGCGATGTGAACGGCTTGCCGGGataacagcagcaacgctcCTGCACG
ATGGGGCCCGCCGTCTTTCAATTGCGTTTGAAGGCGTTCTTCAAGTGGGCGGCGCAGCAACGTTTTAGCTTGCAGATTTCTCGCTACAAATTTTCAAGTC
AAACACTTGATGCTCTTGCTTTTGGCGAGGCTCCTGTGTTGCCCTTCTCGCCACTGCCGGTTAAACGGCATGCGTCATTGCCCGTGTGTAGACGACACCA
CCTCGGCAGCGCTATGGCCAACAGCCCTTCTTTTGTCAAGCGCCGTGGCCGCTTCTCGTTTCAAAGTTTGGAATTCATAGGCGGTTGCGCGTGGCAGCGA
CCAAGGCTCGGCCTTACACTTCAGGATTGCAAGCGCACTGGCCCTGCCGCGACCTACATAGCGAAAAGAAGAGCCGAAGACCTACGAATCGTAGGGCCAA
AGTACGAAACCGTGGCGGTGGCGAGGTTAACACCGTGCTTAGACTGGGCCACGTTTCATTAGTGCGCGGCGAGGCAGCACTGGAAGtgccgttgccgctg
ctgccaacgccGCCTGCTGCCCGTGGCTTCGCGCCATGCGGGCATTGCGCTGCGCGGGTCGCGCTCGTCGGGTCATCAAGGAGTGGTGTGCGGCGCGCTT
TGAAGTAACAGGCAACAACTGCATGTGGAACGTCGCCGGCTTGATCCTGATGCGATGAGATGACTGCGGAGCCCGGCTCTTGGTGTATCGCATAGCGCCT
GGCCTCTGCGCGGCAGTTGGTTTCGCGGACGAACTGCTCGACTGCAAAGTAACCACGGCCGCGACACTGTGTTGGATGGAACTCGTAGGATCTGGGCCGG
GGATCCGCAGGTCCGTATTGCTGGCACACAGAGAGCATGGCGGTCTAGGTTAGCaatcgccgtcgtcgtcggcagcggtggcggcggcagcagtggTGTC
CGTTGAGCGGGCCATGCCATGGCGATTGAGCTCATGACATGTCAATAGAGACTGCGGCGATCTTGGTGACGAACTGAGCCATACCGTACGGTCTCCATTA
TGCAAGAGAAGGGCTTTGGTGTGTAGAAAGCGTCAATGGGCGGACCGAGCGTACTGTAGCGGAGTGTCCGCCTCGGCTCGTCGATGCCAGCGAGTGCAGG
CTCCTGTGCTGCCCACGGCCGTGCCACGCGAATTATTATAActcggcctcctccatctccttgGCCGCGCTCTTGTTCTGGAGCGCTGTGCGGAGGCCCG
AAAAGTGCCGCCTCCCGCCGCGCCTGTGCACGCGGGGTCTtcaagcacttcaagctcTGAGCTCCCTTTTCTGCCGGAAGGTCATTGAGATGGTCGCGCA
CATGGGGCGAGGAAGGCTCGGCCCGCGTTATGTCACGCGGGACCACATTGCCTCATTTCGGGGCGAGTCGCCGCGTGAAGCTCTCGCCCGAAAAACCGtt
ggtactgtacatgtaacttgGCCAGCTCAGTTCTCCTCGGAACATTTTCGACATCCACTTACAGCGCCTAGGGATCCACGCGCCGAAGCAATGCGTAAAT
CTAATAGATCGGGATAATACTATACCAGTACAGTAGTAAGGAACGCGTTCACCTGCGCTTGCAACACAACTGCATTGCGGGCACGATATATTGGATTGAA
CCTCTACGGCAATACAAGCGCTTCGGACCGAAGTTCGGTGGTGCATTCAGTACACTTTAAATCAGGATTCCGAAACGAAGATTTTGGATACCCCGACCAT
TCTCTCCTGCACgtgtactacatgtagtacattTTTAAACATGTTCATGAGCATCTTGCCGCAACCCCACACAAGATTCCTGCGTGGGGGCAACACATTG
TTGAACAATGGTGTGTGCGCAGAAACTTACGATGTTGCAGTATGGCCTCGTCAACGAGAGCTAATATCGATACAGTGGTCTGCTCTTCGGAGCTGGTGAA
AtccttcttcatctacatgtacaatggAAGCAATATCTTTCTTACGAAGAGTCTTATGCcctacaacttcaacatggagacATGGTGTTGCCCTCTGTTC
TACCTCACATATCCCGTATGGGTCATCGTaagcaagtacatgtatatgtacCAGTATGTAGCAAGCACCACAAGCCATGGACATCTTACAGTGTATCCAC
GCAATACCAACGGTCATTGAAGACTCTATCACCCGTCGAACCCGCTCACACTATCCAGCAATGCTTTAGGTTTACACCACATGACAACGTTATACACCGT
GTGTGAGTATCTAGATGCCAACCCGAGCTCCTAGCAAGGCACATCATGCACCCTTTTTTTTATGGCATCGTGCACTTCTTGAGCGTCATTTCCACCATGA
ATACGTGGTGAGCATGAAAACTCGTTCCTTTAGATCTGAAAGACCGGTTTTGAACAGATCTCGTCGAGTCTCCAGTAACTTATGCTCAGTTTGAAATTTG
GATCAGTATTGCGCCAAAAATTGTGATTTAGAATCTGGGTTTTGGACAAAAAATGCGAACGATACACCAGAATTAGTCAGGGCCGGGTGGGCAGCGAATC
CCATTCAAGTCGCCACCACCAATCTGCATCAATGCTGTCGCGTCTCATGATGCTGCGGACGCTGACCGCGCGCGTTCAGTCTGCAGCGTCAACCGCTCAT
CTGGCGCCATTCACCACTACTCAAGTGttctgcgccgccttctctTCGCCAGCCGCCAACCGCCGCGCTCGGCGCGCGCGTAGAGCCACAGCCAGCGCCA
AGTCTCCCGCCGCAGACCCGCACACGCCCACCATCCTCGCGGACATCGACCAGTTCTCGCGCAACGGCCTGGCCCAGCGTGTGGAGATGCCgaaggagat
gctggaccGACTGACGTCCGTCGTGCGCAACCGCACGCACCCGCAGCTCGAGACGCTGCGGCTGAAGCACGTGGGCGACCGCCGGAACACGCGCCAAGTG
CCGCTGGACATGAGCAAGACGCCGCTGGGCTGGTCCATGGACCGTAGCCAGCAGATCCCGCCGTTTTCCTACGGGCCGGGTGAGACGCTGGCCTTCCTGG
CCTTCGAGATGGAGGCCACCTACGCCTGCACACATGCCGTGttcacggagctgcagaagcggctGCCGGACTTCGAACCCAAGTCGGTGCTGGATTTTGG
CGCCGGCCCCGGCACGGCGTCGTGGGTGGCCAAGGACTTCTACGACAAGTCGCTGGACAAGTATCGCGTTGTGGAGCCCAGTCAGTCCATGGCGGACGCg
gcggaggtgctgctggaagacttCCCTGGCCTCAGTGTGCGTCGCAGCATCGCTGACATGTCTAGGGACATTGAAGCGGGAAACAAGTACGATCTCATTG
TGGCAAGCTACGTGTTCTCCGATATCACCAATGACTTTGAGCGTGTGGCGACGACCTCGGCGCTGTGGGAACTGCTGAGCGAGAACGGATGTTTGGTGAT
CGTGGATCGCGGCAGCCCGTGGGGGTCGCACCACGTACGATCGGCGCGGCAGTTCGTGCTCGACTCGGTGGCGGAAGATGAGGATGGAAAGGAAGGTGTC
CGCATCATTGCACCGTGTCCGCATCACTTTGAGGTAATGTTGTTGGAGCAAGATGATCTGAGTTGTTGTGCTGCCTAAACCTAATGTGCGTGTGTTTTTA
TACGATGTCGACAGTGTCCAGCCGCAGGAAACACGTGGTGCCACTTTGTGCAGCGCTCGCCTGTAGTGAACCGACCTCGTGAGGCCACCACAAAGCGTTG
GCACGGTCAGAAGGGCTCCAAGTTCTCGTATATGATAATGCAGAAGACCCGCAAGGGaagcgacgaagatgcagctgccaagatgaagaaaccaATTGCG
CGCATGCTCCGAGGTCCTCTGCTTGCTACCCGCCACGTGCATCTTGACCTGTGCACTCCGGAGGTAAGATTGTTGGTCGATCACGTGTACTCTTTGCGTG
GAATTTCCGACTGACATGTTTGTTTTGCAAATGTGTAGGGAAAGCTGGAGCGTCGCAGTGTTACCAAAGGTAAGGCAGCTCGTGAGGTGTATCGTGCATC
GCGTAAGGCACACTGGGGAGCGTTGTGGCCTGCTGACGAGTCCAGTTGCCTGAAGGACAAGTAGAATCAGAGTTGCCATTCCCAATGAGTCTAATAGATG
CAGATGACCATGAGCTCAAAATGGACGCAGGCCCTACTCCAGGGTTAGAGAGGTGCCTCTTCGCGGACATTGTATCTTAGTCTCTTCAAGTCTTCGTGGG
ATGACGGACAGCACGAGTGCAGCGGGTGCTACATTGCTTGACCCCGGTGTTGCAGTGTTTAATGATACTGAGCTTACCAGACGCGGAGCGTACTCCTGTT
CCGATCTGGACCAGTTAgttgacgacgacatcattgatgaggaagatgacgacggacCTGCAGAAGGACCTTCAGCTTccgatgacagcaacatggtgac
gatggtgctcatgacgctgctgttcgcggGGTTTCTGGCAGTGTGCGGGTTTCTGGTTGTGCAAATGATGCGTGCCGACGAAGCTGCCTTCGTCCGACGG
CTCGAGCAGCGTACGACTTCAAGATGGACTGCACCTTGTCGTGCTGTAAGACTCGCTAACAGTATTTTTTACGGCTCTTAGGCATGCCGCAAGTTCAGTC
TAAGCACGTTCACGTGGAAGTTGGCCTCGCTCAGCTCTACACTGGTGGTCACGTAGAGGTTGGACGTGGAGTTAGGCCGTTTGCCAATGGAGTTCTTATT
GGAGATGTCATGCTTGATGCATCTGTAGATTGACGTAGACCGGATGCTCGTGTGTTCCAAGTGTGCGGGCACAGGCGATGACTCGAGCACTGGATACCAT
ACATGCCACAAATGCCAGGGTACTGGTGTGTACGAGTCAATTGAGCAAGTTGGGCCGTTCCAGCAACGAGTGCGCTCAGCGTAGGTGCTCCATGTTTTTA
TAACGAGTGGACAACCAAGTCTCATGCTGCTTGTTACCGTCAATAGTTGCGACGTCTGCCAAGGCCGAGGTCGAGTGGCACACAGCAAGTGCAGTGTTTG
CAAAGGGCGAGGTCTGCGCCGTGAGTCTACCACGCTAAGTGTGCACGTTGAACGAGGTGTTCGCCACGGTGACGAGCTTTTGCTGGTTCGCGAAGGAGAT
CAGGCTCCACTCCACGTACCTGGTCACATTGTTGTGCATGTGGTaaggttgctgctgtcaaagGACGAAGGCACACACATAAACACTGACCATGATGTCC
ACGCAGAAAATGACCCCACATCCACTCTTCACTCGACGCGAAGACGACCTGGAGCTGACGTTAGACATCACATTACTGGAGGAATGCTCAACCTTCCTGA
TTGCAGCACATTGACGCGAAAGCTAACTGTGACGGTGTTCAATGCTGTAGGCGTTAGTGGGGTTTTCTCGGGAGCTTGTGCATCTCGATGGACGCATTGT
CACGCTAAAGCGTCAAGCTATCGTCCAACCGGCCTCTGTCTGGAAGATTCCAGACGAAGGCATGCCGCGTCGAAACTGGCCGGGGGAGTTTGGATACCTG
ctcgtccacttcaacatcatcTATCCAACCGAGCTAGACGCTGCCGCCAAATCTGGTAAGGACACAAAAAACCACAGCTACCACACACGCCCAGCAAGGT
CGCTTTGCTTCCTTACTCACcttgtgctgcagtcgttTGCCAGCTTCTGAGCGACtgacgagaagcagcttctgTTCACCGAGCATTGTCGTTAAAAAGT
TGGTTCTTTTTTCTTGTATTTAGTGCTCTCTTCGCACGCTTCATGACCTTGGCGCTAGGCTAGCTGCGTAGTATGTGTCTGCGCAGTCCTCTTCATCCCG
CTAACGCTGTATTTCCCCTTCCTAACCCGAGGGTTCTACCACGTCACTCCGTTGCATGCACACTCCTGTCATTCCGCACTCATTCCAaggtcacttcaac
atgcctCACCAAAAGCTCGGGTTGCTAAACTGATGTATGTACCTCACTCTTGATCGATCGTCTTGGTCGTTtactgcagcttgctggcAACCGCGTCCAC
GTGGGGAACGGCCGACAGCTTGCCGATAGCGGCCACAGACGGCGTGGCCTTCAGTGCCTTCTgagccagctcctgcagcttaGCGGCGGTGACACCCTCA
ACGAGCTCCGACGGCGACTTGGACACGAAGCCCGTCGTAGCGATGAGGCCCACGCGGCCCAGAGCACCGGCCTGGGTGCTGTACTGCTCCAGAGCCTCGA
GGGCAGCCGTGGTCTTGGCGGCAACCAGCTCTTCCTTAGTAGCCGGCGCCGAAgcggccttcttgagctcaGCAGCGAACGAGTCCACAAGCGCGCCAGC
CTCCGAGGGGGCGGCGTAGCCCGACAGACCCACGAGAGCAGCGTCGCTGTAGCTCGACAGGAAGGCCGAggccttcttgttgttgaGCCGCAGACTCAGC
AGAGCACGCAGCACCTGCGATGCACCGAAGTCGGCGGACTCGCGGCCCACCGTGGGCAGCGCCAGAGCGACGTGCGTGAACTTggccgccttcttgacgc
GGGTCTCTCCGCCCACGTACTTGgccgtggcgctggcggccTTGCTGCCCTTGACGACCGATCCGAAGTACTGGTTGGCTAGGTCCGAGAGCGTGCTGTG
AGTCACGCCGGCGCCCACCAAAGCGGCGTTGGATGTGTTCACGTACTTGTCGTAGTAGGCCCAGAGCGACTCGGGGCTGAACGCGCTGAGGTTCTCCACG
AAGGCGAGCGGGCGACCCAGCGTCACATCGTCGTAGAACGCGGCGGCGTGCACGCCCTCGAGCAGCGAAGCCGCGTGGTCCTCCGCGATCTTCTGGAACT
CGGCCTGcacgatcttcttctgctcgtccacgtcgtagAGCGCGAACTTGGGTGCGAGCGTCGTCTCGGCCAGGATCTCGGCAGCCGCCTCCAGCTGGTC
GGGCAGAACGCTAACGCTGTAACGCACGAAGTCGCGCCCCGCCTGGGCGCTCACCACGCCGCCGATGGCCTCAATGTCGCGGTACAGGCGCAGGTCTGAG
CGGCTCTGCGTGGCGCGGAACGCCATCTTGGCGAACAGCTGCGACACGCCGGCCgtctcctcgctctcgtcgcgCGCGCCGgtgtcgagctgcacgccGA
TGGTGGCCACGGACGCGGCGCGGTCGTCCGAGCCCAGCGTCAGACCCGACGAGGCAGTGGACGTCGTGAGCTTGGGGGCGGCCGCGGCCACAGGCTGCGA
CTTGGGAATGGACGGGAACTCCTCGCTCAGTGCCACGCTTGGCATGGCATTAGCCTTGGTGAACAGCGAGCGTGATGCGCGGGCCGCGAGcttggaggac
gacgacgcaagCATCGGGGCGTTAGAGGTGGTGGGGTATGTAAACGCGTTTCTGTGCTTCTGGTGGTGAGGGCGGCGGGTGTGAGGCGCTCAGAGCCTCA
CACGAAATGTAGCGTCGGATTGGTGAAAAATGGCCACTAGTTTCGACGAATCAAGAATATAACGTACTTAAGTGAACTTGTACAATACACTTACTTAGTC
GACACATtgctgtaccggtacctaACATTGCGACCTTTCGTGCTCTCTGCCGCTTGGTCACTAACGATTAGGGCGCGGGCGGAGGCACCTGAGTGAAGCC
ACGTCTTGAGTTGCAGGCAACTGGGAGAATCCAGAGATGGCAGGACGGACGCAAGGCAAGGcaagaagagaagcagcagcaagccacAGCGTCAGAGAGC
AATCCACcgcgatggagacgaagcgcgtggtggagcgcTTCATGGTGCACAAGGTGGGCAGCTTCGTGGTGAAGGAGCGCGTGCTGTGCTTCGGCGAGTA
CTCgttctcgacgctggacCGGGAGAACCAGCAGGTGACCAACACGTGGCCGTACGAGGATGTGGACGGCGCTAACGTGCTGGAAGGCGAGACGGACTTC
GTGATCCACACGCCGCGCCACCGCATCAAGAAAACGGTGTACCGCTGCCACTTCCGCATGGAGGTGCTCGTGTGTCTCATGCGTCTGCGCAGCCAGCACT
ACGCCAAGATGCctgaccatcactctgcgCTGCCTGCtgagctgcagatgcacACGTTCCAGAGCCTCAAGTGCCACAAGAACGGCGTGCAGTCCACTTG
CTGTGTGGAGATCCGACCGGACGGCATCTACCAGAGAGACACAGAGGGAGATCTGATGAGTCACATCCCATACACGAGTCTGGTCTCCATCGACCTCATC
TGTGACGATCGCGAAGCCATTGCCTTGAACCACTCGGACAACTCGAGTCTCTTCCTCGTGCCGAGACGCACCGAGCTGGCACAAGCTATCGACCGAGTCA
TGAAGGCCTACGGCATGCAGATCAACGAGTACCGCAAGAAAACGCTGGAGGCGGCGTTGAGACACGATGGCAAAGCGGCGGCGCTGACGACCAGTGTGAC
GTCGTTCGAGTACCAGGTGCTCAAGGTCTCACAGTCGAACGAGTCCAGTGCGGTGCCCAGAACGCTGTCGGTCTCTGAAAAGTACGTTACCGAGTATGCA
GACGCCAAGACGGTGATTTCTAGTCGCCCCTTGTCGCGTATTTACAGTCTCGTCATGTACCAAGATACGCTGCAGGCATTTGAAGTCGTCTATGTGGACG
GAGTCAAGCGCAAGTACTATTCTTCCCAGCGTGAGAAGATCGTGTGTGAATTGCTGGCGTCTTGCCACGCACTGGGGAACTACCAAGTGGGTGTAGAGAT
GACAGAAATCCCAGATTCGATGCGCATGATACCGCGCAAAATCATCTTGCAAGAAGGAAATAAAGTCTCGAATACGGTGCCGAATGTGAACGTGATGGAC
CGAGAGCTCCGTGTCGCGCAAGCAAACATCTTGCAGTTACTGGCGGCACATGGCTATCGGAAGACAGCACGCACTCAACGACAGCTTCCTCGTGGCCTTG
ACGAAGAGATGCACTCCTTGGCGGTGGAGTTTAATGTAAATACGCCAACTTCCGGTGTGATTGCACAGCCTAGCAAGCCATTCGAAAAGGTGCTTTACGT
GCTTGCGCGTGAGCTCCATGACATCGTTGCTCGCCATGGTGCGACGCACGATTTCGTTTGCACGTACTTGCAGTCCCTCTATCGTTTGACGCTTGCTCCA
CCTGCCATCAACGAGTTCATGAAAATTCTGACAGAGGTACATTGTTTGCGGATTTATCATGTACTACTGGGATGTTGGGCTCAATTTTCTTCGTGTGGAT
TTGCTTCATTTTCTAGCGTGGAGAAGAGTATATCGGCACAATATCGAAGATTTTGGCCAGCAAGAATTCGGTTGCTATCTACTGGATGTTCATGGTGCTG
AGCCGGCTGATGGAGTCAAAAAGCTACAAGCTGCAGTGTCGACAGCTGTTGCTATCCAACAGTCTCTTCATGATGACACTCCTTTCATTGCTAGATGAAG
ATGTCCATGTGAGTCGGAGCTGCTAACCATCACTGACAACATACTGGTTACTATTCTAACGCGTATTTCCATTCGTGTTGTGTAGACGAGTTCTTTTTTG
TCTGATCTGCCGACGATGAAATTGTGCCAGTTCATTTTGTTACTGGTGAAGGCAAATgtcgagaagcagcggaaACTCTCAGAAACGCTATATCAGCACT
TGGCAACAAAATACCGAATGCTGCTCCGAATTCTATTCAGTTTTCCCGGTTTGGCTACAGTGGAGGCCTGCGTGGGTATTCTGAGCAGGATGACGAAAAA
CCCAGCGTTTTTGCACTTTGGCAACATGGGCTCTCCGTTGCGATCCAATGATGGAAAGGTTCCTCGACAAACGCTCAGCTTTGGTGAAACCTTAAATTTC
GGTCCAGGTAGCCCGCGTGGTGCGGTAGCTCCACTGTCCTCTCGTCATCCCACGTTTTCGTCCCGAAGAAATAACTACGCGTCAAGCCGAAACAACACGT
TTTCATCGTCAGAGTCTTCTTCTAGTGGTTTGTCTGGTGCTCCGGCTAACGTGGTGGTCGTTCAAAACCCAGAAGTGCTCCTGAGGCAATATCGACAGTT
TCTCGAAGCAGCATGCGGCTCCCTAAAGATGGGGATCGATCAGTACGACGACCCGGTGTTTTTGCGCCTTCGTTATCGATGCCGCAACATTTTCTTGCAG
GAGCTCATGAGCCACTTGGTGGGTAATTTTGAGGAATTCAAGCGCGTGTACAGTGTTGACTGCTGCCAGTTCAGTGGCTTCATTGGCACAGTAGATGGAC
AGCGCGAAAAGACCAAATTTTATTTGACCCCCCGAGCTCTGATTGCCGTGCGAATCGTGACTAGGCATACTCATGAATTCGAGTACCGCACTATTGAAGA
GGTTACTCAAGCGACGGCAATCCCAGATGCGTTTATACTCACAGTGAAGAACAAATTGAAGTTCATCTACTCCGACCAAAGCAGCGACATCGTAGAAAAA
ATGAAGACCTTAGCTGGTGTTATCGGAATCCATCTTCGGTTCAAAATCCGAGACAAGCTTCCAAAGCAGCCAGTGGAAAAGCCACTCGACCAATCAGCTT
TTCAATCAAATGATTTATTTGATGTCCAGAGGCGAACTGGTCGACATGGATCCACATACTTGCGAAAGAAAAAATTGTGCTTTGTTGACGGAACCATTGA
AGAGTTCACCAACTGTTCAAAAAAGGTATACGATCTGAAGAATTTGCGGCGTGTAGTGGTTTCTGGGCTGCAAAGTGACGAGACACAGACTGTGGTGGCG
TTGGAATTTTCAGATTGCAGTCGCGTGGTTTACGTTCCATACGACATCGAAAAGTTTTTGGCAGCACTGTACGATGGATATCGCTACGTCGACAATTATG
ATATATCGTTAAGTCAAGAGTTTCCAAACTTGAACCCTAGAATGTCTCCCAGGGCATTGTTGAAGGACGAGCACGAACGCTTCCTCTATCTCAACCATGA
CGGACTCTACATTCCTGCACacgcggtgctggagaaagAGATTGACATGATGAATGGGGAAGGTGTAAGCACCATGTCCGCGACAAACAAGGTCACGTTT
GCGCTCGAGAGCTTGAATATGAATGTTGAAATGGAAGATTTTGTGGGGAAATCCATGCGTGGACGCTTGGAGAAGCTATCATTCGGTCCTTTGCTTCGGG
GAATGAATAATCTGGTAAGGGAAGCTTGGTTGCGCTTTTACTATTGTATAAGCTAATTAACTTCTTGGTTCtgatgttcttcttgtacttACGGTATAGC
TCGAGCACGCCTGCAAACCACCAATTCGCGCGAACGAAATTTGTGTAACGCTGGAAACGTTTTGTCGCATCAATGACGGTTGCTATCGGATTGCAATGGA
GCAGTCAAACGGTGGTGCAATGGTGGTAGTTCCAACGCTGGCTCAAGTACTGGTCTCTGGTGACCTGATCGCCACTCTATGGGCAGTAAATGCACTTCAC
TCGCTGGTTACTGACAAATCACGGTCAAATTCGCATCGTGCAGCTGAAAAAGCGATTCGGTACCAAGTGTTTGAGCATAAGAAGCTTATTTCGTTATTGA
CTGGACTTCTGGAGCAACGCAACCCAAGTTCCACGCTGGTCATGCTGCAACTGGTGCTGGATGTATTAGTCGTTTCTCGTCACAGCACCGATAACAATCA
CTTCGATGCCATCGTAAAAGCGCTGGGGGGAAAGTATACACTGTTGCTGGAGCTAGCGTCTCAAACCAAGAATGCAGGATTAGCCGCAGCTGTTATATGC
GTCTTGAAGGTGATTGTTGATCATGGTGATCATAAAGTGCGACGGCGCATTTGTGACGTTGCGCTGGATTCAGGGCTTACTGTAAAGCACCTGCACAAGG
CGTTTTTCCACCCTTCTGATAATGCAATGGAGACATATCAGTACATTGCCAGCATCTGGGTGACTCATCACAAAGCCTCTCATGAAATGCTTGTGAGAAT
CCTTCCCCATGGATTTATTCGAATGATTTCGAGCCCGATGGTGCGTAAACTGTTAAAGAAACAACGAGCTCGACAGACCGAGTCTGTGCGACGGAAGAGT
AAACATCTGCTTCAGGGTCAAGTTGATGGATCAGAATGGTTCATTCGTCGTATGCAACTCCAGATCGGAACACTGTTTGCTAGTGGTTCCGTGAAAGAAG
CTCGAGTCAAGGAAGACTCCTCGCGCATGAATTACCCTGGTGAATCATCTACAGACATGGCGTTACTGTCGAGTATGGTCTGCAAAGATTTCTTGCTTCC
AGATTTGATTTGGAATGAACTAACGCGAGGTGAATTGAAAGCTGCTCTCAAGTCGGCGATCGAAGAATTCGATCAGTTCAAAGTCAATCAAGCAGCTGCG
TTATCCTTAGCTGTCTCTCGAAAAGGAAATAATGAGCTCAAGTGGAACCACGCCCAATTTTCTGTGAGGTACGAAAGCATAgctcaagagcttcaagttg
aCCGATTTTACCTTCGTGTTATCACGGAAAGGATAAACGATGGATCTTTGCAGCTGGCGGAAGTTGCCAAAATTGTCCGTGCGATGGAAGCGGGAACACA
TCGAGGAAAGCTGAAAAAGTCGAGCAGCCTCTTCTTTGCCAGCATGGATATTGCTAAGGATCCGGCAAAGTTTTTCAACGAAGTGTATCAGTGTTGGTTG
GAACATCTTCATCTGAACAATATTCCACTGTCAGGAACAAACGATTGGTCCGCAAGCGGAAGCAACGGTTTCCCACAATTTACTGGAGCAACTGGAAGCG
AGCAACATGGTCATTCCATGCTGAAAATCCTGATTGAGTTAGCCGACGTATTCCCCGAAGCCCGGCCTATTACGAAACACCGAGCACGATTTCTTACTGA
GCTGTTACGGAATTCGTATCTGGCGAGTGAAATACAAGACATTGTGGAGTTGATGTCTGGATTAAGTCTGTCCAGTGAGACCTGCGCCGAGTTGTGTACG
AAGAATCACATTCAAGTGCTGTTATGCATGTCAATGCTGTCGCACAGGTgccagacagcagcactagGCAGCGACGTGACGAATTATCAAGGTGATATAC
CGATGATGGACTCGCTGAACATGTCGGAATCAAACGATACCTCCTCCGTTCCGATAGCAGAACTTTCTCTCTACAATGAATCAAGGTTTGCTTTGAAATG
GAGCATAAAGCTTAAAGCTGTgggagaagctgaagaaggcggtgtGGTTAAAGGCCCGTTTTCAGCGAATGAGCTAAAGGAATCCCTGGATGCTGATCCG
TTCATTCGACACCGCCAGATTGATGCTCTATatgtgtgctgctgctctgcgcaTGGGCATGAACATCCTGGCAGCAATGAACACACATGGAAGTCGATGT
TTGAATTTCCAGAGTTGCGATGGATGGAGCTAACCGATGAGTCCATTGACACAAGTTGTGCGGCATTCGCATTGAAAACGTTGAGAAATTTCATGGTCAA
AGATCAACGCACAGTGTCGGTTGGGAACAAAACTTTGTGGCCATCTCCCCTGGTAAATACGGTTGTGGCTAATACGTCTTCATTTGCCTTGCtcgttcag
ctgcttctggtaAATAACTCCAACGTACGGAGGTACGTCTGTGAGATGCTGATGTCTCTGAGCGAAGAGGAACTGCAAGAGCTGTACAAGTATGGTGCTT
TCTACTTCATTTTGTCAACGGTTGCGAACCCTAGAGGAGCCGATAAGGTGCCTGCGTTCGTTCCGGAAGCAACACTACTGAAACGGGTCCATCGAATCCA
GCGATCATCGGAGAGATACGTGGGACAAAGTTACTTAACGGACATGCTGCCTGAGTCGCTCATTGCGATTTTGGACTCGGAGACCCCTGAACGCTTCGCC
GACGTATATAGCGGCCGTCAGCACGACAAGCGCGTCCTGTGGTCGTCAGCAATGAGGCTGCATTTGCAAGAGATGATGGATGAACACCTACGAGAGTTCA
AAGAAAACTTAAAGAACAGTGTCGCAGAAAAGTACAACTACACTCCAATCCCTCCCATCTCATACCTGGAGTTATCTGGAGATGTCTACTGCAGTGGCTT
CTATCTTTCAACATTCAATCAGTCTAATTCTGATGCCGAAGAGGTGGAGGATCCTGTTTTCCTAATGAAAAGCATTGAAGAAAAGTGGCGGTACTTAGCA
CGGCGTCAAGCGGATGGTTTGGAGGAGGATATGGATCACTCGGACGCGTACGAAATATTTGGCTGGAGCGAAGATGCAACATACTCTTCATCTGATTTGC
GCACACGTTATCGGGAGCTGTGTCAGCAAGAGGTCGAAATGACCACAGTTCGTAATGCATTTGATTCGCTTTGTGCTGTGCTTGAGCGCAAGAACGAAGC
TGACGGCGGGCGGACATCGCACGAAGTTGTCGAGCGTATTCTGAAATCTCAACTTCAGTTGCTGGACAAATATGGCTTTCAGTTTTTTTCGTACGAGTCT
TCGACGCTGGATCTACTCGTCCATGTGCTGTCATCTCAATTGACAGGAGAGTCTAAATTTCGTAGCCTCGCGATGAACGTGTTGCAGCGACTACTCTCCG
TTGCGCCGCAAAATGGCCCACTTCTGGTTACGATCGATGGTAGTTGGGATGCGGTCCTCGACTTGGTTGAACACTGTTCATTTGGACACGATGTGGCAGC
GAAAGAGAGCATGTTCTCTAttcttcaactgcttctcgCTTCCGAAGAAGGGGTTCAATCACTTTTGGGAGGAGGTAAAATTACGTCTAACGAGGTGCCA
CCGTCGAAGGCATTTGATTTCAGCACCTTTGGGGACGATGACAACACGTCATTTTTTACTGCGACGGAGTACACATCTCAAAATGGAGCGAGCAAGTCTA
AGCACGCCCAACGTGTATACTCGTTGCTAGATGATGTTATCCTTTCTTTCGAGAACATTCAACCTTGGCATATCCAGAAGAAGTCGTTTGAAATTGCGTC
ATCACTTTGTCGGAGCCATGCGCTCCAAGAACAAATCATGACTTTCACGCGGGTATTTTGGAAGGGTCTGTATTTGATCTTAGCATCGGCCGAGAGTTCA
TCAGGAATTGATACAACACAGGAAAGTACTACggcgttggagaagcaggaaCTTGATATGCTGGAGAGCGCCTTTGGAGCACTTCGATCACTAGCCTTGG
GTCCGGACGGTAATAGCCGATCTGCGGGGCTTGACGCTTTAGCAAATCTCCTTCCGATGGACTTCTTGGATTGCCTTGAAAAGCCTAACGGACATGACTT
CTGTACCATTTTGCTGTCGAATATTCGAGAGCCGACCTGTATTTGGAACGAAAGTACGCGAACCGAACTCTCTCAACTTACGGAAGAATTCTGCACGGAC
CCTAATGGTGATGGATTATCTTTTTTGGAAAGTGCCACGAATCACATGTACGATTGCCTCAGCACAGAGCCGTTCGTTGGAGGGATCTATTTGCTTATCT
TACTGGAAAAATCGGAGGAGAATCCCCAAGCGATTACTGAAGATACGCTGTACCCGACCACAGTCGTTGACTTTGTGGAATCGCTGTTTTTGTTCTTGAA
CGAGAACAGAGATCCTAAACTTGGTATTTATTCTGATACGCTACCTGCATTAGACTGCTTAAGTCTTCTTTGTGACTTGCCAGCCTTCCGACCTACCATT
GTGGAGTGCTTGGAGCAGCACGTTGATGATGTGGATCCAGTGAACGCCTCGATTTCGGTGGCAACACTGGGTAGATATTTGCTGCCATTTGACGGTGATG
ACAAATCAAAGGCTGTATCGATATCGTCTCGTCGGTCACTGTCGACGTATGGGTTTAATGCTAAGGTTGAGTCTGATGGTGTCCCTGCTGCGATAGAAAC
TGAGTTTGGAAATGTGGATTATTTGGCCCGCCAAGAACTTGCGCTGCTTATCCTGAACAAAATTTGCGGATTTGAGTGTAATCTGGAGCGGATGTTAGCA
CCTTTCTGTCAATTCACGTGGTGTCTTCAGGTGATCACGGATCATCTCGGATATGAGCAAGCGTTTTATGCGCTGTCCTGCTTGGCGGAGCTGTGCGACA
CTTGCCTCGTAATTGCCGAGTACGTGCAAATTAGCGGGCTGTGGGTCGAGATATTGGGCATCGCGCTTCAATCCCGGCAGCACGTTCTTCATGAGCATTT
CCTCCGAGCTGAAGCGCTACGGGAGCCCGCATTTGAAGTTTTGTATGCATTGCTGATGAAAGACATCGCATTGCGCGAGAAGATGTACAGCGGGCTTTGT
CGATTTCTACCTTACCCGATTGTGTATCAAATCCACCTGGACCCAAGCAAGGCGACTCGATTCTTTGACGACAACCACGACAAGAGCGACTTGATTTGGA
ACTCTCACAAGCGGACTGAagtgcgcaagaagctcgaccAAATTGTTTGCCGGAACCGAGTGGAACGGTCTATAGCAAAACGAGACTCTGTTttgctcga
cgacgagactGATTTTATCCCGTTTCCCCACAATTTTGTGGCGGGTCTCTATATTAATCGCTTCTTGTCTCGACCGGATCCAGAAAAGTTGACAAACCCA
GCATACAATTTAGAGCTGCTTTTCCAGGTGTGGAGGACTCAACTGGACCAACTGATGAGCTTCGATCTACAAAACCCGCCCGAGAACCTTAAGAAAATtg
ccgacgagatcgacAAGTATACCATGGCGATAACGCATATTTTACGGGCATCACTTGATATTGACGAGAGCATCGCTAAAAATCGCATACCGGAACAGAT
CGTGAAGCTCGTGCGCTACTGCAACCAGCACTTGATCACAAGCTTCCCGTACCGTTGTATCTTGCGTATCGCTCGGCGCTTGGTGCAATTTCCCGAGATC
ACCTCGAAAGAATTTGTGGAACTGCTTATTTGCCGAATCACTATGCAGCACCCAGATATTCCGTCTTTACTGAAGGTTCTTCGTCGTGTGCTGGAGGCAC
GCAACACGGTGTTGACAGAAAGCGGAACGAAGGATGATCCCGAGTATTGGTTGAAAGACCTCAAATACTATCCCCAGATGCTGGCGTTCCTGGAAGGGTT
GGTGGAAAACAAGGAGCAGGTCGAAGCCCCTCTCCTTTCCAACGTGAATCGCGTGCTGCGCATCATTCATGCTGAAGAGCCAAAGGAAACCCATTTGAAG
CAGATATCTCGTAGCTTCATGGGACGCTGGCATAACTTCACGTTAGAAAGCAGGCCATCGATGATCCGTAACTCGATTAAGACCGGGCAATCCGAAGCGA
AGCCGTCATTGGGCACGACTACAACGAACATTGAATCGGCCAACCCGGACATCATGAGCACGCAAAGCTTCGACGTGGATGGGGCTAGAGGGCAATCAGC
AGATGTTGCAAGTACTCGAAGCTTCGACGTGGATGATGAGAGAGAGCCTTCCATCCGTGTCGACATCAAAGGCATACCTGATGACCGCGAAATTGACATC
GATGGCACCTTTATCCACGCACCTCCGAAGAGCATCAactttgctggtggtgcggTTGAGGTGGGAGATGCTGTTGCGCCTCGCAGCTTCCGGTACAAGG
GCGAGATAGCTCGCAATTCACCGTTGTCATCTCCCACGTCGGTTCGCTACTCGACATTAGGAGCTCGATACGAACCGATCGACTCCCAATATCACTCGAA
AAAGGCAGCTGAGTACGATGAGCACGAGGATGATGAGGACATTTTCGCTACTCGACCGCGTCGTGGAAGTGTACCATCAAAACCAGACGATATCGACGTA
AAAAACAAAAAGAGGGGTAATGGATTggctactgctgctgctgctggaggcggcaTCCCCatgagcagcatcaacgtcaacaacTACGACTCGCAagcgc
cagcaactcgtcgaCACTCGCAAGCAACAAGTGAAGTCCCGTCGGAAGCGACGACATATCTGAGTCGGCACAGCGGAATGAGTGGCATAAATTCTGATCG
ACGCTACTCCCTGCTGGATTCCTGGAAGCCGCCAAGCTCAGCGGCGCCGAACTCTTCGCTTACGTCACTCACGATTTCccgacgaggacgccgagctgct
gccgtctACAGCCGACACAAGTCCAAGGGCCGGAAGAGATGGTTCAACCTTTAGACAGTTGACGGCTTCGTTCACATCTTTTTACTTTCTTACAAAATTT
ACACTTAaaaaggcaagttgaagttgaagttaagaccatcactctgcgTTTGTCCGCATCCGAGCAAGTGTTTCTTGTCGTGCGTGGACGTGCAGGTTGT
AGAGTTCCAATGAGTTGGCAGCAGAATGCGGTGCTACAGCGCACCTTTGAGGGTCGCGATcaccaaggagaagaagcttctGACCCTCCGGGTGCCACAA
CGACAGATAGCAGCATCCTTTGCTACATCAAGACGCTGACGAACCACCAGACAAacgcgaagcagcagcggatgGATCGATACCTCCAACAAGTCAAGAG
CACGCAGCCTGCAGAGGGATTTTCGGCGAGAAGCTCGAATCCTCCTGGATACCATATAACTCAGCGCCAGGGTTTGCCAAAGGCAGTTAAAGCGCCAACG
ATGCAGCTGTTGAACAAGGATGCCCCAAGAGAGAAACACAAGCGGCCTGGAAGCTACTCTATTGCACAGAGTGTGCATAGCAACCGAAAAAAAGTGGCTG
GGTCCACGAAGGACAGTCGTCTGCGATCGAAGCGTCCGCACAAAGGAAGTCAAGGAAATCGGCAACCGAAGAAACCTAAACTGGCCCCTAGCAAGCACCA
GGTTACGGCTATCGGGTCATTGGATCGATTCAGGCTACATGGTAGCTGGTCTCAGGAAAAGTCGCAGACAAGTGCAAGTGAGGAGAATGCTGGTAACAAG
ACGCCCCAACATGCCGCAGCTCCGACTGAAAATAAGACTGCGCAACAGGTTCAGCTTGGAGGTTCGACACGCATGCCACCAACTGCGAATCTTGGATTCA
GCACTATAAGTGCTGACTTGGAGCCGTGGGGGGGTGAAGTGACGTCTAGCGTTCAGGTTTGTTGGTGTTGAGCTAGGAAATGTAGCAATGTGGTTTGCAC
GTATGATACTGAAACTGTTGGTTGATGCCAGGCACTCAAGCCAAATCCACTCAAGGCGCTTACAGCTCGCACAGTACCAGCTCCAACTCAAGATCCATGC
AACAACTTGATCCAGCACACCAGCTTTCTGTCACTGGAGGAGGCGCAGCCGGGGAACCGTGACTGTGCTCTTCCCCAACAGGAAGTCTTCGCTCCAGCTT
ACGACCCTCTCAGTGTCATCATGGAGTCGATTTACTTTTGATTTGATAGGCATAACGACGTAACGCGCCCTTCGAGCCCTTTGAGCTAGTCGCAATCTTC
AGTTCGCAAAGGTCGCAATCCTGGCGGATTCCTGCGTCTACATATCGCCATCGACGATGCAGCCCCACGCTTGGTGCTTGctcttggtggtgctggtggc
gcaaTGCTGCATGCGTTCAGGTGGAGAGCATGTATTCGCCCAAGCAAGCGACCTTGGGAATAATTATCCGTCGTCGGTGTCGTTGTGTGGAGAGAATCTC
GCCAAGGAGACTGGCATGCTCAACGGTCTCTACTACGTGTTTTACGAATCATCTCCCACAAAAGTTGGTGTTCCCGTGATTCTGTGGATCTCGGGTGGAC
CTGGATGCTCTGGGTTGGTCGCGTTGCTGTTCGAGAATGGTCCTTGTTCATTTGATGACGAGGCGGACAAGGTTCTGGTCAATCCGTACTCGTGGACTGG
ACTTGCTCACGTTATCTATCTTGACCAGCCTAAAGGCACAGGATACAGTGACGGGGACAATGGAATCACGCACCCTTGGTCACTCGGAGATGCAGCGGAT
GACATGCACGAGTTCCTCCAGCAATTTTACCTGCAGCATCAAGACCTGAAAAGGAGCGACTTGTACATATTCGGAGAGAGTTATGCTGGACACTACGTAC
CAGACTTGGCGGTGAGACTGCTCGACGGGGACAGCTCACTCCCGACTCTGAAGGGCATCGCAATCGGTAATGGCGTCGTGTCGACTACAGCTTGGGTCGA
GTCGGAGATACCATTCTTGAAATCCAACGATTACGGCTACGACCTTCTTGGGTCGCATGAGGAAACACTTCGAACCTTTCGCGATCGGTTCGAGTCGGCg
attgcaagttgcaggAGAGGCGATAACTTACGTCATTCATCCTCTGAGGGTTTTAACTCTGACTGTGGTGAGGCTTTCCAGAGGCTCGCGGACTTCGAAG
CACAGACTTCATCCTCAGTCTGGGACCTTGGCCGGAACGTGTACGATTTGCGCCGTGAGTGCCACCTCGACGACGGCCTTCAGTTGTGTTATCGCTTCTC
CCGTCTCGAAACATTCGTGAACAGCCCAGGCGCAAGTGCTTACTTCCACGGAACTCCTCATGAGTGGAAGCTGTGTTCTTCCGGAGCACTTCCGGAATTG
GCAACAATGGACAAGCTTGAGGAGAGCGAGTCGAACGTCGCACGAGCTCTTGAGCACGGCGTTCGAGTGCTCGTCTATGGCGGCGACGCTGACACCGTTG
TCAACTGGATGTCACAAGACTCATGGACGCGTGACCTCGCTTGGAAATACCGAGCTGCGTTCAGTTCTGCCTCCTTCGACGAACAAGCCATCGAAGGACA
ACCTATCGGTCGCATCCGCACTTCACACGGTCTCAGCTTCATGAAAGTGTACAACGCAGGCCATGtgcgtccaccaccaacccCTGCATATatcctctct
ctctctctctaaCTCCCTTGCTCTCTCCGTGTAGATGGTACCTCACGACCAACCTGCTACTGCGTTTGAAATCGTCCGCAGCTTCCTCTACGACGCTCCA
GGAGTTGGCATGTTCAGTTAGACACACATAGAGATCGACACTCGCAGTAGTGAAATAGTCAACCAACCTCCCCCTGAACATCTAAACGCGTACGAACATG
CACTTAGAATTACTAATTAAACCCCTCGGGACACCAGACCTCAGCCAGCCAGCGGGCTTCTAGTCTGTCTACCTACCTCCTGGACTGCTCCTGGTTGCAT
GACAAACAAAAGACGCGGTCGAACTGCTCGTCGCAGTTGAGCgtcgagcacagcgagcaGAAGACGTTGCGGCACGCGTCGCACTcacggctgcagcagt
tgcccATCGTCCTCTCGCAGTGCGAGCAGCGCTGCATCCTGCTGGCCTgcagctggcgcttggcGGGCATCCCAGAGCTATCgcacacagcacagcacgc
CAGTGGGGTCTCACTCTTGCAGCCGAACAACTGgccgatgctgctgtgcttcTTGATGCGCGCGTTGGTGATCGCCGCCGACATCATGCGACTCAGCGCG
TCTGCTTTCAAGAAAAAGCACGCTTCCACAGTCAGTTATGGCGTTAAAACACGGGTTTCGACGAGGAAAACCACGCACCAACGGGGACGGAGCGGTCTCG
GCAGCGCTTGGCAGACGCGTGCGGCGGTTTCCAGGGCGACATGGAGGCCCAGagagacgacggaggcggTGTCATGCCCACCGCGTCCATGTCGCAATCC
TCCGCCATGCTCTCCTCTCGGGAACGCTTCATGTTGATATTAACGAGTAAAGCCAACAAAACTCAGTGTTGAAACTATGTGCTGTGCTGGCCGCGCGCTA
AAGCGGAAGTGAGGCGGTTGATGGCGGGAAGCATTGGCGCCTATTCGTTAAAGTACGAAATAGCCTCTCTCCCCTGACGGATTTACAAAAAAAGAGAAAC
AAATTGCAAAACACGGTCTATTGAAGTCTTAGTGCTTCCAGCTGCGAAAACGACACACAAAGGAGGGAGAGTTAGTGAcgctacaacttcaacggcaaca
tCCATCGCAGGAGTTCACTTACATCTTGATGGTGCGGTCCTTGCTGCCCGACGCCACCATGTCTCCGTTGGGGCTCCAATCCAGCGCGTACACCTCGTCA
GCGTGACccgacagcgtcgtcttggCGTTCTTCGGCTCACTGAGCTCCCACACCTTCACAGTCGAGTCCTTGCTAGCCGTCACGATCAGTCGCGCGTCGC
TGGACCAGCACACCTGGTAGACCGCACTAACGTGGCCGGTGAGCGTGGCTACAAACTTACCAGTCTGGCCGTTCCAGATCTTGACCTTCTTGTCAAAAct
ggcgctggcgaagtATCGTCCGTCCGGTGAGAAGCTCAGGTGGTTCActgg