Description :
From Genome Similarity Track
Location :
Scaffold_1046:6845- 7861
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1046-snap-gene-0.2ATP-binding Cassette (ABC) Superfamily

Sequence
1016 bases(100 bases per row)
GAAGCCGAGCAAGTACAAGGAGATCGGCAAAGGCGCGCCGACGTCCTTCAACTTCCGGCAGCTCTACCGGTTCGCCAAGCCCGTGGACAATGTGCTGCTG
GCGGTCGGCGTGCTCGCGGCCGGCGCGAACGGCGCGCTCTTCCCCATCATGGCGCTCGTGTTCGGCGACGTGCTCACGGGCTTCTCGTCCATCCCGCTCG
ACATGGACCAGGTCAACTCGGCGGCGCTCAACTTCTTCTACATCGCCATCGGCATGTTCTTCTCCGACTACATCTCGTACGTCGCCTTCTACATCACAGC
CGAACGCCAGATGAAGGCGCTTCGCGGCGAGTCGCTGCGCCACATGCTGTACCTCGACATTGGCTGGTACGACGGCCACGACGCGCTGCAGCTCTCGAGC
CGCATCACGGGCGACACGGTCAAGATCAAGGACGGTATGGGCCAGAAGCTCGGCGACGTGTTCCGCTTTGGCGTGCAGTTCGTTGTGGGTTTCATCATCG
GTTTCTCTCGCGGCTGGGACATCACGCTTATCATGGCGGCCGTTATGCCTTTCATGGCGGTCTCGCTCGGATGGCTCATCAAGACGCTGCGTGCTCGATC
AGAGTGGGCTCAGAAGATCTATGCTGAGGCTGGTGCCATCGCCGAGGAGACGCTCGGCTCGATCCGAACTGTGGCTTCGCTCAACGGCGAGCGCCGCGCG
ATCGCCAACTTCCAGAAGAAGACCTTTGAGGCTGAGGCTGAGAACATTGCGCTCCACAGAATCACGTGCATCGTCTTCGCCATGTTCCTCGGCAGCGTGT
GGATCATGTATGCTGTCGGTCTCTGGTACGGCGGCTGGAAGGTGTCGCAAGGCAAGATGGCGCCGGGTGATGTCTTCTCGGCTTTCTTCGGCGTGTTGAT
GGGTACGGGCTCGCTCGCTCAGATCTCGCCGAGCGTCACGTCGGTGTCTCAAGCTGCTGGTGCCGCTGAAGAGCTCTTCAAGATCCTCGACACTCAGTCT
CCGATCGACGCGTCCA