Description :
From Genome Similarity Track
Location :
Scaffold_258:6843- 16196
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_258-fgenesh-gene-0.1Rad51 DNA recombinase 2
Pytar_ATCC12531maker-par_contig_258-fgenesh-gene-0.660S ribosomal protein L35
Pytar_ATCC12531maker-par_contig_258-snap-gene-0.15Calmodulin-binding WW domain protein

Sequence
9353 bases(100 bases per row)
AGGCCTTTGGCATGTTTCTCGAGTCGGTGAACCGCCCGCTCATGCTCCGCACGGGGCTGCCGGCCGTCGACGCCGCGCTCGGCGGCGGAATCCGCCACGG
CCCCATCCACGAGGTAATACTATTATCCTGGCAAGCGCTAGACCCCAGGAGCTAGAAGGAGACTGAGCGGGCGTGTAGCTGGCCGGCACGTCCGGTATAG
GCAAGACCCAGTGGGCCATGACGCTGGCCGTGCAGTGCGCGATCGAGTACCCTCAGTCACGCGTGCTGTACGTGGACACTGAGCGCGGGCTCAGCGCCAA
GCGGCTAGACCAGATCGCGCGCGCTCGGCTGCGAGGCCGCTTTGTTGCGGGCAGTGCGGACGGAGAGGACGCCGTCGGGTCCGTGCTTCAGCGCATCCTC
GTGCATCGCGTGGACTCGCTCTCGGCATTTCTCCAGTGGTACGCTTCTTGCACGTTTAGTCCCATCAATCAATCTTCTAGTCCTAACGGTTAGACCAGTC
TGAAGGAATTGGACCAACAAGTGGTGACCCAAAAGATCCAGCTCCTGATCGTCGACTCGATCGCCGCAGTGCTCGTCAAGGTGACTGCACAGTTTCGACC
CATTGATTGATGGGCCTAATGTGATGGGTCTAACGTGATGGATATCCACAGGCCCATGAGCTCACCTTCTCGCAGCGCGAGCACCAGCTCCAGCGGATCG
CGGCCCGCCTCAAGTTCGTTGGCGACGTCCACCGCGTATTTGTCGTCGTCACGAACCGCGCGACGACCGTCGAGAGTGAATGCGCGTGCTTTTGGCTATG
TCGCTTGGAATCCTAACCTAGGCACTGACGAGGGCGAGTGTTGGAGCAGTCACGTCGTTCACCAAGCCGCTGCTGGGCGAGACCTGGGCCCATTGTGTGA
CCTCCAGGGTACGTGCATCCGTTCGTTTGCCCCACGCAAACTCCTGTATGACTGATGGCCCTCTCTACAAAGTTTGTGATGGAGCGGCACCCGATGTTCC
GTGCCATCAGCATCGTCAAGTGTCCGTCGTCAGACCACATCGTCCAACCCTTTGATCTCACGGTACGCTCTACGGGCCATTCCGAATTAGAACCCCGACC
AACGGATCCTCTATGAACAGGCGCTCGGTGTCGAGCCTGCTGAAGAGCCAACGTTAGGCAGAGCCGATGGCGACCTGGACGACGACTTCAGCATCCATGA
CGACGTGCTGCGGGACTTGGACCTCTCGGGCCTGCCCACTGTGGCGCCATCGGCCACGCTTCGCTCGACTCAGCAGAGCGAGGCTTCCGCCCAAGACGAA
AATGAGGAAGGGAACGAGGAGCCTGACCAGACCGAGCCAACATCCGTCGCGGTCGTGATGGCGAGTGACGATTTTGTGAGCGACTCGAATGAGGAAAGCG
AGGACGAGGAAAGGTGGCGGTGATCGGTGATGCAACAGAGGTGATCCAAGGAGCGAGACAAGCTGCACGTAGTTGGGAAAAAGCGCAGCGAGTTTCCATG
GTCGCTGGGAAGCGCGAGGTGCCAGTGTATTCATCCAGTCCAAACAAGTCCCTGTCTAAGATCACCCACCACTTACGCCTTGAGCGCGAAGCGGCGCTTG
GGGAAGTAGGCCTCCTTCTTCTGCTGCTTGACCGTCTTGAGTCCCTTCTCGTGCTTGGTGAGCTGGCGACGGATCGCGCGCGTCTTCTTGCGGCGCAGGT
CGAGCGGCACGTACTTGCGGCTGCCGAGCGACTCGCGGAGCTTAGCCTTCTGGGTCTGGTTGTACACCGTCAGGACACGGGCGATCGACTTGCGCGCGAC
CTTGATCTTGGCGAGCTTGGACGCGGCACCGCCAATGACCTTGGCGACGCGGAGCTGCGCGAGCTCCTGCTGGAAGTCGTCGAGCTGCGTGAGCAGCTCC
TCCTTGTTCTTCGAGCGAAGTTCGTGCGCCTTGACCTTGATAGCCACTGTGAATAAGAGGAAGCAACGATCCGTCAGCATTTCCATTTGATAGGAATCCA
TAGCGGGCGACGCATTGGTGTTGGACTGGAAAGCGGATGACGAGAAATGCGAGGGGGCGAGCTGGAATCGGGAGCTGTTCAAGGTCGCGACCCTGGATAC
TTCGGCAAAGATCACCGGCTGCATTAAATCGCTGCTTCGACGATCATCGGGCCTGTCCGCCGCCGCGGTATGCTAACGCGTCTGCAGTCGCTGTATTTCT
TGATCCGACGGCATGGCCACAGCCACGAGGCCTCCCTCTCATCGGGTCAGAAAAGCCCCACGAGCATTTTTTCCATCGCGCGTATCTCGCCTTCTACGGC
GGCTCTGTCGTCGCCCCCGCCACGCTCGAAACCACCGTGAGCTCGCCATTCGCTCTGCCCGCATTTCTCGGGCTCCCCACCCTTTCCAACGCCGCAACGC
CCCGCCCCAGCACGCGCATGACTCACCCATGGTTGTTCGTCTGTGTGAATTACTTCCCGTTGTGCGATTCGCAGAACCGAAGAGCTCACTCCAACAACCA
CGAAAAGGTTGGCTGGACAGAATGCCACCAGCGAATACGCGCCACCTTCGCGTTACCACACGATACTCAGGATGCTTTTCACCCTTTTTGTTCAATGAGA
CCTTGTCTTCTGTAATATTTAACCAATCCACGCTCACTGGGGTTAGGGCCTATAACCACATCCACCTTCAAGCAACATCACTGGCCCACAATCAGAATGA
TGGTCGTTCTAGTCCGGTTCTTGAGTTTCATTGGTCAAAATTTTGAAGAAATCCACGGATCCCCTCAACAAGAAGAGCTTCCAATTCCACAGTCGGTCTC
TTCGTCCATCATGCAGAGGCTGCTGGTCGCGTTCCTCGCCGTGGCCGACGCGTCTCGGCTTCGCGCACCAGTGTTTAATCCGCTGCAATCGGTCGCGCCG
CTCTCTCTAGATGAAGGCGCATTGGACAACGCGACGGCGCCGCCCGTGGACCGCGTGTTCGAGTACCCCAAGGATTTCCGGCTAGACGAGCCGTTCACGC
TCTCGCTGAGTTCGCACGAGTCAGTGCTCGTGCCACTGGAGCCGATCCGCAGCAAGCTCTTTGGCAACAGCAATGCGGGCTCGACGGCGATTGGCTTTGA
ACTGAGCACGTGCCAGGGCAAAGTGCTCACGACCATCGCGATGCAAGACGGCTCGTCGCGCCGCCTTTCGTCGGCTGACTACCAATGTGCCACGATGGTG
AAGACGCCGTCAACGGTGCCGGTCGATCTGTGCCCCATCGTCCGTGGCGATCGCGACATCGCAATCCACAAAGACCCGACACAGGTCAAGGGCTTTATCG
TCCGTGCGTACGAGTCGGCCGAGGTCGTGGCGCTACTTCGATCCACCAAAGACAAGGGCGCGTACAACTCGGCGTTCTTCTTGACTGCCGACCCCGTGGA
AGCTGATGCGTCGCGGCGCCTCAACGTCTCATTCACTGCCAAGTCCACGCAGCTGGCGTTCGCATCCGCTCGCACATGGCGGCCGTCGGACAATACGACT
ACAATCTCCATCTGCTTGGACTGCGAGTTCGCGCTGTACGCTCAGATGGCGGCGCCACCCAACAACTCGGACTTGCTTCCGCGGGCACCACCGCCGCCTT
ACTGCTTGAGTAGTCGAGACTCGATCAAGTACACACTTCCGACCGTGTCGAGTTCGGCGAGTCAGCACGTGACGCTGCCGAGCGGCTTCGGCGACCTCTT
CAGCACCAGTGGTGAGTACAGCTTTGTGCTCGTCGCGTCGATGCCTGCGTCATCAAACAACGGCCACCCTGCATATTTCACGTACGCGCCCGCGCGGGTC
ACGGTCGCAGGTAGGATGTTGCTTGGCCTTGCATTGGCATCTTTCTGGTGGAGTGGCCCTAACGTATCTCTGCTTGACTTGACGCCTTTTGCTTCCGCCT
GCATACTCTAGCTCCAACGCACTTTGTCTGTACGTGACATGCTTGGGCCTTGAGCATTGCCCTCTTGCGTACTGACAGTACATTCTATGGTGATAGCCCA
CATCCTGGTCATGGTTGGCGTCGTCGCGGCGGTAGCATTCCTGTTCTTTGTCGCAATCAAAACCGAGCTGCCAAGACGTCTAATGACCTTGCGATCCAAG
CCTGAGGTGGCACCACACGACGAGGAGTCTGTAAAGCTGCTGGCGCGCGTGATCGCCGAACAAGACGCCCACGATGCTGCAGGCGGCCACGAGGACAGCG
ACGAAGAACACAAGTCCGAGTCGCTTCTTGACGTGATTCGCAAGACAAAAGCCCAAGAGTCGACACCGCAGCCATCGCCTCGCCGCCCGCAGGCAGCGCA
ACTCGAGGGCTACCACGAGATCAACTAGGCACTGATCACGACTTCGCTTTGTCCTCGGCGGCCGCCGCCTCTTGATCCGCCTTGGAAATCAGCAACTGAA
TGGTCTCGTCCTTGAGCTTGACCAGTCGCTCCAATCTCGCTTGCGCTTCTTTGAGTTCCTTCTTCTCGATCGAGTCCCTCAGTTCGTTGACAATGTACAT
CTGTACTTCTTGCGTCTTCTTGAAAAACGACTTGGCGTCGCCCATGAATGTGTCTGTGTCTTGAAGCTCGATCCATTGCAGCAGCTTGACCATGTTCCAG
CAATCCTGTGTGCTGCGTGGGGGTACGGCGCACGCTGTGAGGAATCGCTCAGCGTACTTGCCACCAAAGTGCGTGTTGGTCGCGACCACGTCTTGCCAGA
ACCTCGCGCACGATAGTGCCTCGGCCTCGGTGCGTAGACGTGTGTACACGTTCCCTTCGAGCGCCTTGATGGACGCCGGGAAGGCTACCACTGCATGACG
TCGGAAGACCAACCGCGGCTTGTCCAGTGGTTGGAACGGATGCAGCAGCTGAATGAGCTTTTTCTTGGCGAGCGCGACTCGTGCGTCCACTCGATCGCGG
TCCTCGCCTTCCATGCGTTCCAGTAACACCATGGCTTTGGGCACGCTGAGCGTGCGCTTGTTGAGCACGACGTTCCAGTATTCTTCCTGTTGCTCGTGCT
TGTTGTACTCAACGACCCAAGCGTACTGAACAACATCATGGAACTCGATAGACTGCAGGTACAAAAGCTTGGCACGCCGCGCAGCCGCCTCAGTGAACCG
CGAGATCTTTGCCCGTAGATTCCTCGCCGCATCGGTTGCGACTTCAGATGAAGGGACGTACGGTTGTCGGAGGATCTCGTCCTCATCATAAGGCATGATC
TCCTCCCACTTGACAACGACTGCGCGATTCGCCAACGGAATGAAGACGAGCACGTGACCAGTGGTGAACATATTCTGCGTCGAGAGAATCGACCCCACGG
CGCCTTTCCATTCGCTTGTACTTCGAGTGATCTTGACCTGCATGCCGTACACCAACCAACTCGTGGCGGCCTTCTCAACCGCGGCGCGGGCTTTCTTTGT
CCAACGTTTCTTCCTGTTCTTCTTCTTCACCGACTTGCCGGGTGTCGCGGGCTTGGCATCCGCTTCTTCACCATCATCGTCGTCACCATGGCGATAGAAG
AACAGCGACCTCTTGATCGATTCGATCCGTCGCCGCCGAGCTTGTGTCTCGTCGTGAGTGTCGGACTTGAGCGTCGGCTGAAGCCCAAACACGCTCTTGA
TTTTGTACCCCAACGATGACCGTTTCCTCTCGTCTTTCAGGCGTTGGGCCTTAGCCGCATGGGTCTGGCGCACGAGCTTCATGTACGATTTGCCCTGTTG
GCGCACGTGGTACGACCGCACCCACGCTTGGATTTTGGTGGCGCTCACTTCGCGCACCTTGCGTATCCGCTCTTCCTCAGCTCGTCGCGCATCTCGCTCT
CGTCGTTTCTGGTCGTGAAGTTTCTGCGCGTCGGCTCGGCGCTTGGATTCGGCCTTTTGCCTGAGAACGGAGAAGTAACTCAGTCGATGGCACGGATGTG
ACTGGCGCTGACCTTTAGCGTGACACTTGGACAGGCAGCGCTTGCAAAATGCGTCTCCGCACGTGTCGCATCTCCACTGCGCCACTCTCTCGTCGCACTC
GACGCAGGCCACTACCAGACGCCGGTACCGGTGCTGCAGTTGCTTGACGGATGTTTTGTCGTCAGTTCCAACTGATGGACCGGATCCGCTCGCCTTGTGG
ACAAACGGGAAGCACGCATCACAAAAGGGGACTTGGCCGTCTCCGCACTGCAAACACTCGCGTGTGGCAGTCTCGACACGGCAGTGGCTACACAACGCGA
TCCCGCATTTTGTGTGCGTATGGAAAGCCACTCGTTTGTCGTGGTCTCGCGCAAAGCACGTCGCGCACATCGGATCCTCGCACTCGACACAGTACAGCGT
GGCTGGTACTCTTCTGTGCGGATCCGTCGCCGATTCGTGGCGTTCACAAACTGCATGAAACTCTTCGCCAGGGAATGGCAATGGAATTCGGTGCTTGCAC
TGCACGCCCTGGAGAAATGCTGGTCGCCGGTTGTTGACCACAATTATCATTTTCTTGGTCTCGACAAGTTCGAACCGAACCGAACGGCCCTTGTAGTCGA
TATACTCGATAAACATTTGCGCAAGTGTTGCCTTGAGCGTCGCTCGGAACTTATAGATGCGATAGCGCCGCTGCAGCACGCGTGCAGCTTTTGCTCGCTT
CTGCTCAAGCATGTGCCGTCGGTACACGATGATGAACTGGTGGTGGTGTTGCTTGCCTGTGATGCGGTAGGCAAACCGCCGCAAAAGTTTGGCGGCCCAC
TCGATTCGTTTGGTCGTAGATTCTTCGAGCAGTCTGCGGTATTTGCCGTTCTGAAGGGTCGATGGCAGCACAAAGTCGTGCATGAATTTGAGAAAATGGT
CTTGCTCGAGGTGCTTCTTGGCCGTTGTTGCGGACACATCGGGTTGGCCCTCCGCTGGCGCCACTGCTTGCTTGCCTGGCGACGGAGTGAACTTGTCGTG
CCACACCATGGCCATGGCCTTGTTGAAGCGCGGGAACGGAATCGTTCTCGCCTTGGGTTCTTTCATTTTTGCAAAAATCAAGTCAACCGTTTGGATCGGA
AACTGGCGCTGGTTGATAAACCCGCGCGGCATGGCCTTGAGAAACCGTGCGAAATGGGAATTGTCGATATCAAATGAATGGCCCGACACGTCGCGATACA
GCTCCTGCCAGATACCATCGTAGCCTCGTCGTGTCCAGAGTTTGTGCGTCGCGTCAACTTTGTAGAGCGAGCGCTGGACGGACGTGATGTCGACGTCATT
ATCCGCCCCCACATCGTTTTTGAGGATCTGTATATCACGGTGAATGAAGCTCTGAAGCAGCAGATCATTTCCGACGCGCTTTCGTGTGAGCTTCATCAGG
GCGATGCCCATGGCGTGTTCTTCGGCCAGAAACTGCTGTCGGCGAACGGCTTTGAACAGCCATGCCTTGCCCATCCACCGTCGCCACGCACGCTGGATGC
GTCGCGCGGCTATATGGCGTCTGCCCTGCAGTTCCTTCTTGCGTCGCACGCGCCAGCGGCATTGCATCTTCATGATCGCTTTCAGCACCGCGCGCATGCG
GAATAATTCTCGTCGAGTCATGAACCCACGCCATGCGCCCTGGATCAGCGCACAACTACGGTGTACCATCATGTGCCACGCTTGGTGTCGACCTTGGATG
CCACGGACGCGTCGCTGGATGCAGGTCGCGGCCTCCTTCCGTCGGTGGTTCACGCGTCGTCGTGCCAATTCCTTTTCTCGTGCATGCTCGTGCTTGAGTC
GCTTTCGCAATCTAGTGCCACGCCATGACGCTTGGATGCGGGTGGCCGCGGCGACTTGTCTCGCACTCGGGCCGCTGTCCTTCTTCACGGGCAAACTGAC
CTTAGCTACTAGCCCACCCCACGCTGCCTTGTTGAGGTTAGTGGCTAATGGTATCACTCTCGCTTTGCGTAATCGTTGTCTCTCGGCGAACGCAGCCGTC
TCCGCGACTCGCAGGGCTTGTCGCTGCCGCTCGACTCGCTGTTTGGTTTGCCGGGCGATGTAGCACCGCCACGCACACTGAATGACCGGAATCGCCTTCT
CAAAGCGCTGGCGGTGGTTCATGACCCACCGTCGCGCACGGCGACCACGGAAGTGGGCTTGGAGCTTCAAGATCTTGGCCTTGTCGCGTTCAAACTGCGC
GCGACGGCGCCGCAACGCCAAGATGCGGCGCTGAACCCACGATCGAAAAGCTCGTTGGATCACGATCACAGCGCCCAAACGATACCTCGTTTTCCTTCGC
TCGATCTGGTCTTTCTCTCTCTGGGTCATTTGCTTTTCCACTTGCTTGATTCGCTGCAGAAGGCGACGTCGACGCCGTGCAAACATGCCACGCGCAATGC
ATTGCAACGCAATCGCAGCTTGGCGACGGCGTTCCTGCCGCATGCGGTTGCGCAGCGCGATCCACGCGGCCTGCTGATGGCGCCAGAAACGCTGGAGTCT
TTTGGCCGCTTGGTCTCGTCGCTCAGTCTTCTCACGCTTGCGTAGTACCCCGCACCGACGGATAGTCCGTGTGATGATGCACGCGCTCTTGTTTTCTCGA
CTCGCTAGCAGCAGTAGAAGAGCGCGCTGACGTCGTTCGATCTCTCGTCGCAGACGTCGGCGACTCGCGACTTCTCGCAACGCCCGCAGTTGACGCCACC
AGCATTGGAGCACCAGCGTCGACCGCGCCACGATGGCGTGTTTGTAGCTCGTGATGACGAGTTTCCACTGCGCCAGTGCCTGGATAATGAGATTGTATCG
TAGTCGCTGCCCTACACGAAAGAGTAGATCGGCTGCTCGTTGCTGGGCCGGTGATGCAAACTTACCCAGGCCAAACTCGTAGAGAACGTCGAGTGGGATC
CACTGCTTGATGTCGTGTAGCGTTTGCTCGAGTCGCGCGTCGGCTGCATGCGTGTGGGTCATTGATGTCTGCTGAATGTTCACGAGCTGTTCGTGGTCGC
GCTGGAGCTTGACCCGCACGCCACGCGGGAGGCCAGTCGGGATCATGAACGTTGAGCCATGTGCGTCGACTCGGGTCTTCAAATGCAGTGCATTGATGTC
TTCTAACGCCATTTGGATCATCTCGGCGCGCTGCAACGCCTGATGAGACAGCCCCGCGCGCTTTTTCCACAGCGGTCTGTTTGCTCGCGGCTTGGCCGTT
CGCTCGAGTACGCTCGGCTTCTCCGGCAGGGACCTCGTCGCCATCTTGCGATGCCGAAAACCGCGACTCGGCGAACTGCGCTCGTCCCCAAACTTGCGCA
GAGCCGTGTACATGGACTGGCGTCTCGGGCCGGCGTCGGCAAATCGCTCGAGCTCGTCGATCGCACAGAGTTCGTCTCTGGTGAGCGCCGGTAGTCGCGC
TAGCCGGTCGCGCGTGCGTGGCGACACGATCGAGAGCACGGGCAGCACGACAG