Description :
From Genome Similarity Track
Location :
Scaffold_98:68428- 72168
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18993nardilysin-like protein
Phypa_INRA-310PPTG_18994voltage-gated Ion Channel (VIC) superfamily

Sequence
3740 bases(100 bases per row)
CGCTATGATCTCATACAGGGTGGATTCGACATTTCATCTGTATACTCGCTACTATCCGGGCTTTCGGCTAACAATGTCCGTGCCGTCTTAGTGGCGTCTT
CATTTGCCGACACTCTCAACCCAAATGATCTCCAGACTGAGCGATGGTTTGGTACCAAGTACACTGTAAATTCAATTCCTGAATCAGTGATTGCAGCTTG
GTCGCAGCTTTCGAATGAATCGATCGAACTGTCGGTCTTGCCAACACCGAATCCATTCATGCCTCGAAACTTCTCAGTATTGCCGTTGGAACCGGTTATT
CAAGTTGATAATGACACTCCTCCGGACCTCATCCTCACAACGTCAACTACACAGCTCTGGTACAAACGCGATCGCAAATTTTTGGTGCCCAAAGCGAGTG
TCAGCTTCCTCGTGACGCTACCAGAACCAACAGCAGCGATTCATATGCTCGCAGAGTTGCATGTCGAGTTGGTTAGACGCCGTTTGCAGCACACGTTAGA
GCAAGCTGAGACTGCAAGTTTTACTACCGAGTTGGACGTAAGGGACGAAGCTATTGAGGTGGTGATCTCCGGATTCAGTGACATGTTGCCGTCGCTGGTT
GTTGTCATTATGCGAGAGGTTTTGCGTCCGTCCACGACATTTGATATTGAATCGGAATTAACGTTAGCGCGAGGTGAACTCGAACGTGAGTACCGCAATG
CTACATTATCTCCAAGAGCAAAAGCTTACGAGTTACGCTTGCAGATGCTAGAGAGCAGAGCTGTCACTACGGACGACAAGTTGGAAGCACTTCAAAGCAA
ATATGGACATGAGAGTGACCTTGCAGCTGATCTCGCACACTTAACGGTCTCCGTTCTCGGATGCAGTAAAGATACACCGGTGATACGCTGCATGGTGATC
GGCAACATGAGTCGGGAAGCTGCTGTTTCACTCGTTCTGGACGTTGAAGCTGTCAAAACTGGAGATTCTTCCTTGCTACCCTGTGAACCAGAACCAGAGC
TTGAACCAGAGCCCCCGATATTGGCTCCAAGATGCCACACGATAGCTCTACCACCGACAACCAATGGTCTACTAGTACGTCGTGATAGTGAACGCATTGG
AGAGCGGAATTCCGTGGTCGAAGTGTATTTCCAGATCGGCAAAGTCGGACCGACAGATCGAGCGTACGCTATATTATTGCGCTCTCTACTGGCCCAGCCA
CTCTTCCACGAATTGCGAACCAAGCAGCAACTGGGGTATACTGTGACTTGCAGTATTCGAGACACACACGGTGTACTCGGACTGAATCTGAGCGTACAGT
CAGCCTCGCATGCTGCCGGTGCCGTGGCCAAGAAGCTCGATGTCTTTTTACATGAAGAATTCCCACACGATTATCTGCTCTCCGATGAACGCCTTTCGCC
CAAACGCTTTGCAGCCTACGTCCAAACTCTGCAGCGAGCTTATGCTCGACCTGACGCAACGTTGACTGAGCAAAGTGAACGATACTGGGAAGAGATCGTA
AGTGGACGTCTGGAGTTTGACTTGGATGCGCGAGTAGCGACTGCTCTTGGTGACTGTACGCGTCAAGGTCTACTCGAAAGGTACCAATGCTGGATACAAG
GAAGCACTAGCTGCTGCAACACGTGCACTCAATCTCGTGATGGGAACCGTCAAGCTCAGCACAGGAGCAGCAAAAGTCATGGGACACGGAAACTCCGAGT
GCACGTTGTGGGCCAATGCAGTCCATTGAAGCCACTCGAGCAGCTCGTACCTCCTGGCAAAACTCCATTCATCATAACAGGAGACTTGCACGATTTTAAG
CGCGAGCTGCGGTGCTACTGCCACTTGACGAGTGACTAAATTGAGAAATCTATTGACTAGAGAGAACGGATATCTACATTTCCACTGTATCCAACCTTGT
CATCCTTTGCCTTGCCCATCGTTTGTTGTTTGGAACTCGAGCAACTCGGACGCTGTCACAAAGTTGTGTACGGATGGCCGATGTGAGGCGGTGGCGCTTA
CACGTCGTAAACGCGGTGAAGGGGGATTACTACCAGCAGTTGGTCCATCATCGCTCGTCTTTAATGCACGAAGAAGGAGGTTTCGTGTGGAACTCCGAGT
CCTCGACATCTCCTTCAATGCATCGGACACTACTAGACGCTTCTCAAGGTTCATTATTCGACTTTCGAGGCTTTCAGAGTGTGCGTGCATACGAGCTTTC
ATGACTTCCACTTCTCCTGATACTCGAGATACTTGCTCCAGGAGACTTTGAAGTGTCAACTCCAGCATTACGGCCCAAGGCGGAACATTTTCGGACGATG
AGGTAGCGGCTTGGGTAGAACTAGAGCCAACGTTAGGTGCCTCGTTGGCTGTAGAATTACTGGGTATTTCTTGTGAGGTTGGTGCCTCCTGTCGAGGCTG
ATATGATTGTTGTTGAGGCTGTCGAAGTGACCACTGCAGTTGGTTCGGTTGTTGCTGTAGCTGTTGTAAAAGTGTAATTGAACTGCTGGTGCTTGGTAAT
GATACTGAACCACCTCCCCCGCTTAATGGCGGTGATGACTCCGGGATGGTAGCGGCAGCTATTAAGTTACTAAGATTGCGTTTACTACGCGATCGATCTC
CATTTTGGACCAAGAAAAGCTCGGACAATTCCTCAATCTTCGCGCGGATGTACTCAACGTTAACCTCCATCATTTCCAGCATGGTCATTTGTGAATCCAT
GGGATCACTGACATCATGAGAGTGCACTCGTCTCTTTACTTGCCGATACTTTGCCAGCACTGTGAACAATTTGAGCTCCGCTCGACGCAGGGCTCGTTTC
GTACCGCTGGTTCCTGTCGCTTTGTCCTCATGAACCTCCGTTGTCGAAATGTTACCGTGACTACTTTCGCCTCCTTCTAGTGAGGCAGCTCGGTTATGTC
GACGTTGTGCTGCTCGAAGCTGTGCAAACGCCTGCAGTGCTCGAGCCGCATGATCATTTATTAGCCGTCGATGTTCGTCTTTCTTGAGGAACGCATTGAC
TTTGTGCTCCGACCGTGTAAGTACTAAATAGTTACTCATGACTGCGATAGTCACTGCAGCGGAGAGAGTACCGAAGACTCCGGCACTTACTGCTATGCCA
CGACCAAGAGTTGTGCGCGGTACGACGTCACCGTATCCGATGGTGAGAATTGTGATGATAAGCATCCAAATCGCGTCGCCAAGTAACATGGGTTGACAGC
AGGAATCCGCTTTAAAAGCACATAAGAAGCGCTCCGCCACGTACATTGAATACCCAGCAACGAACCCAAGAACAGTAAAGCTTGTTATCAGACATGTGGT
AGGATGATTCTTTAGTGTCGATTTCATGAAGAAAGTTGCGGTAAAATCGACATTAGTGAGCGCTCCAATGAACCATCCGTTGCTCGAATTGAACGCGTTA
CGGAACTGCACCACTCGAATTATGAGAATCACCCGCGTGAACATTACGAGGCTGGTGGCCACCGTTAGTTGAGGCCATTTCGGATCCACGTCCTCAATTC
CGGGGAATGGATGTACACCTAGTACGGCCATTTCAATGAGCAGCGAGTGTCGCAACGAAGAGCTCAGCAACGTCGCCTTTGGTGGCATAATATTCTTGAG
TTTCATGACTTCGCATTCTGCTGCGTAGTAGAGATAGATATAGTACAGCATGAGTGCTGTGGAGAAGGAAATAAGCACTCGCAGTGACAGTAAAACCATC
CGACCTTCGCTCACTGGTACATTTGTGTCTAAAGCCTCAA