Description :
From Genome Similarity Track
Location :
Scaffold_16:68425- 69897
Transcript NameFunction/comments
g18060.t1XP_009526607.1 hypothetical protein PHYSODRAFT_351217 [Phytophthora sojae

Sequence
1472 bases(100 bases per row)
CAACGCCACCGAGCGACGGGAAGGCGTCCTTGTCGCTGGCGTTGAACTTCTTGTTCTTGTTGCTCTTCTTCTTGGGAGACGAAGCCTTGGTCGGGGTGGT
AGCCTCAACGGCAGTCTCGGCGGTCTTCTCCGCCTTCGGGCGAGCCGTCTGCTCGCTGAACCAGACCTTCTTGGCCTTCACGGCAGCCAGCGACTCGGAC
ACAGCACCCACCGCCGACGGCGGCAGCAAACCGACGGAGCTGAAAGCCTCCATCTGCGCGAGCGGCAGGACCAGCTTGGCGGCCTTCTTGGTCTTCTTTC
CGCGGGCCTTCTTGCCCTTCTTGCCGGCGCCGAGCATCATGAAGTCCTCCTCCTTGCGCTGCAGGGGCTTCATGCCGTCGAGCTCCACGGGGGCGGCCGC
GGTCTCGGCCTTGTCGACCTGCTCGTCCTTGAGCTCCTTGCCGTACGTCTTCTCCAAGAAACTCACGAGGGCGTCGCACAGGTCCATCTCGTTCTGGAAG
GGGTGGATCTTGGCCATCTCCTTCTCGTAGTCAGCGAGCTTGGCCTCGTACTCGGCCTTGCGGCCTTCCTCCTCCTTCTGGCGCTCGAGGTCCTTCTTCT
TGCGCACGAGGCGGATGTTGTTGTAGTACTTGTCGTTGGCCTCCTTGAAGTCCTTGCGCAGGGCCTTGATGGCCGTGAACTTGTCGTCCAGCTGCTCCTT
AATCTCCTTGCGTTCCTTGGCGAGCACGGGGAACTGGTCCTTCTGGTTCTCCTCCTCGTTGAGGCGGTAGAGCTCGTCGAGCGCGGCCTTCTGCGCGTTC
AGCTTTTCCTGCACCGCGTCGATTTCCTCGTTCTTCTGGGCCTGCAGCGCACGCGTCTCCTTGATGCTCTCGTTCTGCTGGTCCAGGACGCCCTGGTCAC
CCGAGACGGCGCTCACCTGGAGCTTCTGGGCCTGCAGCTGCTCGATTTCCTTGATCACGCGCTTCTCCTCGTTGAGCGACATGGAGCTCGTCTCCTGCTT
GTGTCGCAGATCGGCGATGGCCTGTTCGAACTCGAGCTCTGAGCCAAACTTGAGCGTGGCGCGCACGCTGCGCTGCTGCTTGACGGACGCGTCCTTGGCG
TCGCGCGTCTGGCGCAGACGGGCCGTGATCTGGTTGCGCTGCTGGATCAGGTCGTCCTTCTGGCCGCGCAGGGCCGAGAATTGCGCCTTGGCCTCCTGGA
TCTGGCCGCCGTAGCCGCCGCGGTTCGTCTTGAGCGCGTCCATCTCGGCGCGGATCACGTTCGTGCGCGCCTGCAGCTTCTTGATAGCGGCATCCAGCAC
CGAGATCTTGGCCTCGTGCTCAGCCTTGTCGGGCTTGGGCAGGCGCTCGATCACGTCCGGGATCTCGAGCTCCTGTGGCTGCTCGGCGACGACGGCGGGG
ACCTCTTCACTACTCATCGTATGCGGCTTAGGATGACACGTACAGTCTCTCTATGAGGGGGATTTTGACTGG