Description :
From Genome Similarity Track
Location :
Scaffold_378:6841- 8138
Transcript NameFunction/comments
Phyta_totarag7739hypothetical protein

Sequence
1297 bases(100 bases per row)
tcgatgGGCCTAGTGGCTTACACTTGCGCAACCTCACTTTGGCCAGCCCCAACGACCTCTGCGGAGGCACCTGTGGccgcaagctgaagaaagtGAGCAG
TGTTGGACTGTGCTCACTCTGTCAAATTCCGATGTGCTCCAAGTGCCGCGTTACTAAGAAATTGACCTACGCTACCTGCGAACTCAAGCTTGAACGCCGA
GAGAGTGTCATTTGCCGCTCGTGCGTGGCGAAAGTGCGTCTTGAGCCTGTGCGTAGTATCGCACAGCAGGAAATCTGCAGAGGCCGCTACCGCTGGCGTC
CCAGCAaccatctgcagcaggcgcaaTCTGTCGAGGCTCAAGCTACGAAGCCTGCAGCACTTTCACTATTGAGTGGATCTGCCTGTTCAAACCCAACTTC
AGGATCGCTCTTTCCCTTTGGTGGACCAAATGTAAGTAAACGCTCGAACGGCGGGTCCTCCGGTGCTACTGCGGGTCTCCTGGATTGCCAACGGATtcac
cagcgtcagcagcagcaggttcaaAGTCAAGCATCTAGTGCTCGGCCGGTACTCCCGACCAAGCCTCGCTGGTTCAGACGTCACAAGAAGCGTGAGCAGC
CCAGCGCCGACTCGAGGCCAGTGATGTTTGGCGAGTCCACGATGCTTAGCGAGTGCCAGTCGGGCACGCTTTCGCAGTGTTCGACAGTGGTCGACTCAAT
GTGCACGACCTCACCGATCAACCCGCTCACTTACAGCTGGGGCTCGTCCACCCAGGAAAGCGAGAACCACGCCCGCgtagacgaagacgacgaagatgac
tGGGCCGGCACACCCGAGTTCACAGACAGCCaacaacagcgccagcagctctggaaTCAAATGACGGAGCTGCGGCTCGCTGTGGAGAACACGTACCAGA
TCGCCAAGCACACGACGGAGTCGTGCTGCGGTCCGAGCTTCAGTCCACTGGGGAAAGCGAGCGCACAGAAGTAAAGTAAAACGCGAGCAAGTTCATCTCG
ATGTATGAGAGATGAACCGCGACAGAGAagtacgagcagcagcgcacgtGAAGCGCTCACTACACTATGCAAATAAAATATGTTAAATGAAGTgctcatg
ttgaagtcgtcgtgatAACTGGAGTAATGCAAAGCATTAGCTTCATCAactcgacagcagcaggaccCACACCTGTCAACAGGGTGTGGCCAATCAACTC
GATCGAGCAGCCAGCGCTGAGGTGCGCTAAAGTACTTGACGCACTCCTGCCATACCCAACCCGTTCAGCTGCATGTGTCAAGACGGGAACGTTGCTT