Description :
From Genome Similarity Track
Location :
Scaffold_3163:684- 2633
Sequence
1949 bases(100 bases per row)
TATATTCCGCGAAGAAGGACAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAA
GGGCGTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTG
AGCTGCCTGGACTGGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGC
TAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCA
GTCGACGTCCTTCTGAAGGAGGCTCGACAAAGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAACCCAACCACTTTCGA
AGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTT
TGATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTC
CATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGG
CGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCAC
TCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATC
GGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGT
GCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCAT
GACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTATTCACCACGTCCGCATAC
TCCGTCACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGACGTTCTCGT
CCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCGATCTCTCCAGCCTTGAGGTTGGCCAGGAAAGACTC
AGCCGTCATTTCCTCGAGGTTCAGTATCTCTGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCCGTCTCGCTATCGAAG
ATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTTCGGATCCGACT
TGAGGCGGCGGCGGCGTCTTTGCCGACGGCTTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGACATCCGAGGCACTCGTGGC
CTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGACACTGTGTTACCCACACAG
GAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGG