Description :
From Genome Similarity Track
Location :
Scaffold_152:68371- 73747
Transcript NameFunction/comments
Hyaar_Emoy2811293hypothetical protein
Hyaar_Emoy2811294protein phosphatase 2 putative
Hyaar_Emoy2811295pleckstrin-like domain-containing protein

Sequence
5376 bases(100 bases per row)
AGCTTGCTTGTGTTCCAGACTTACCAACAATGATCAAAAGTGAGTACTCGCATTTGAGCTAGTACAGATGGTTCTTGAAGCAATCAGCGATGGGGTGTTT
GGAGGCAGATTCAGCGGAGGGCAACGAGTACCGTAGATATTGTATTTGTAGTACCAGTAGCGACTCGTTAATTATCGGAATGCTGCACATGTGGTATGCC
ATCCATGATTTCCGCAGGATAGTACAACTCCGAAGCTGTACCACAACAATAAGCAAGAACACAACAGGCTCCAAACTTTTGCTGTGTATCTAGTATCACC
CGATGCTCGTTCATGCTTGAGTTCTTTCTCGCAGACCGTAGTCATCTTTCTTCGGAAATGTGGTACAGGCGATATCGCCTAGCTAGCCGAGCGTCGAGAG
AGCTCGCTGTGCAAAGAAGACAACATCGGTGTCACCGTCTTGCAATAGGACTCCCAGGCACGGGGCTATAGTATTCATGCGAGCTTCCGCATCTACTTTA
GAACCGAGCACCTCCAATGTCTTTGCCACATTGAAACGGATGTTCGGGACCGGATCCTACACAGCAGCAACAACAGCAACAACGAATAGTAAGAAACTTC
ACCTCCACACCTACCAGCGATACATCATCGCCACAGTGTCCTGACCTGGGCCAGCTCTACAGCCAGAGGGATAAGCAGCGTTTGTATCAAGTCGGGGGTC
ATGGCTTCGCAAAGCACATTCACCGCGTGCAAAGATGTCAAGCGATGCAAGAAGTTGGCATTCGAGTGCATGGCCAGAATTCGCGGGACCACACTCGCAC
GTGCCCAGTCCACACCAAAGTGCTCCGTCAAGTTTTTCAAGTTGACCGTGGCCGCCTCCCGAATCGAGAAAACGTTGTCAACCAACCACGCCATGCACAA
CTCGGCCAGCTGCTCTTCGAAGTAGTCACGCCCCAACTGGACAGCGAGCAGCGGGATATATTCGATAATCGCGAGACGAATACGCCACTGGCGATCTTCC
GCAAGATGCACGATGGCAGGCAGAAGCGACTGCGACAACAGCTCGATTCCAACCACCTGTCCACAGATATACGTGAGCAAGCCACACAACTTTTGACTGT
GCATGCAGAGCAGACGTACCGTGTTGCCCTCTTCCAGGTTCGAGATAACATTCAACCGCACTTCCGAGTTTTGATCGTTGAGCAGCTATAGTTAACAAAA
CGAATCAGCATAACGACGTGCTCCCAGACAGACAAGAGCCATCACACATCACGTACAAGCAGAAAAAGAGGCAGCAAGTGCTCAATCGTGAGGTCTCGGC
CCAGAGATGGAGCGACCTTCATCACTACAGAGGCCAGAGCAGAGCGCACGTGGTCGGACATGTCACGCGCCAGACGCTGGAAGCAGGGCACAATCTTATC
CACAATCCGCTGCGGCTGCAGAAGCCTCGCAACACCGAGAATCTTCGACGTGGCTGCAGTGCGTACCTCAGCTTCATTATCCTCCAGCAACGAGACAAAT
GCGTCACAGAACGTCGAGTTAATAGTCTCAGCAGTCAACGCGTCACAAATCTCTGGAAACCGGTTGGCAACCGACCAACGCACACGCCACGAGGCATCAC
GTGCCGTCTCAAAGATGGTCGGCAACACCTGCGTCGGAAGTACATCGGACGGCACGAGGCGTGCCAGCGCAACAGCATTATCGATCGTGTGTATTCGAAC
TGAATCCTGGCGGTCCGTTGCCAGTGTCAAAAACAATGGCAGCATCTCCGAGCTGGCACTATGGCTGTCCATTACAGAAGCAAAGCCACCAAGGGCAGCA
GACGCAGCTTTGCGCACCATCGGCGTGTCATCCCGACAGAGCTGGCCGAACATACCGCGCATCTCTGCTTGCATCTCAGTCGAAAGACGGGAGTAGCCAA
CCTGGAAGAGGCTGCACGAGGCAATACGCGACGTGAACCAGTCACGTGTGACAAGTCGCCGGAGCACCGGTACAAAGTGCTCAGCCACGTGTTCCGCTTC
CGATGCTTCAACGACTTTGCAAATCGAGCGCACTGCCATGTTTCGAACAGAAGCTTCATCGACTGTTGCGAGCGACTCCAAGGGCTTGAGCAGCAAATAA
GCATGAGCTGGACCTCCCACCAAATCCACGAAATCTCCGAGTTCTTCAGCCATCACGAGCAGCACTTCATCTTCATCATCGAGCGAGTCTGGTATCCAGA
TAAAGAAAGAGAGAGAGAGACCGTCATGACCACCTTGATACTATCGAAACAAATGGAACACACAGTCTAAATTTTTTTGTACCGTTCATAAAGGGCAGCA
GCTCATTCTGCGTCCGTTCGTGCCCTAATGCCTCGGCTAATAAATAGAATCGAAAAAAACATACATTATTGTAACCGGTATTTAAAAATATATGTGAAAA
GGTATTCATACAGGAACCCTTTATACTTAATACAAGTGAGGGGTGGAGAGGGACGTACCAATGATGCGGATCTGGCGGATCGAGTTGAGACGCAATTGAA
CGTCTTCATGCTTCAGTTCGTCCACGAGGATCGCAATCGGGTACAGACTATTGTCTTCTGTATTGGAATAGTGGTATAACCAATCAGAGGTTCATCCCAC
GTTTTATAATTAAATTCAAACTTAATTCTTCGTACCAGCTACAGCCGCCGCCATCTACACGCTCTGCTAAAACAAGAACATTGAATGGGTACAGGGTTGT
TGGATATTTCAGATAATTGTTAGGGATTTATATGGAAGGTAGTGTCACACATTACCAGGCTGAAGGAAGGGAATATGGAAGGGAAGACGAACACACGGAC
GGACGGACGGACTTCGACTTTTCGTATATGCTCGTGGAAGCGGAGATCGCGTGCGGCGTATTTGGAATATTGGCCAATTGGAAATTGACAAGGCGATGGT
GGAGCTTAGTCATTGGTTCCCGTCAAAAACAGCGGGAGACTCGGAGTGATCTAAAATACGGATGCTGTATTATTTCTGACAGGCAGTTAGAGCGAAGCAC
CAAATTTGGGTTTATCGCTTGCGCTATGATCGTTTCTTGCGCACAAATTTGGAACATACACGTCCTCATATTTACTTGGGTCGGCAGGTCAGGACAGGTT
AAGGATCGAATTACATGGAAGATCTTGGAGCAAGCTTTGGTAATGTCATCATCGATCGAGCAGTGAGAAGTGAGTTCAACTTACGAGAGAAAAGTGTGCG
ACGTCAAGTCACCATAAGATCATTTAGAATGAGAGAATGCAGCTCATCATTCACAACGAGCAAATACAGCATAGCATCTTCCTCCGACTCCCATGATCTC
AGTAAGTGAGCAGTTTTGACCCAGACCGACCCATGCGCATTAACGTGGTAGGCAACGTAAGCATAATGACCTTGTCTTCTCAGGCAACGAAGTAAAGTTT
GTGAGGTGGTCGTCGACCTCGACAGTAGAATAACTTCATTACCGTGTAAGGATCCCTAATAACTGGAAACGAGGCACGACTGATGTCGGGAATGAAGTCT
GCGGTTTGTGGATTCGTACTTTAACACTTCATCTCGCAAGAATGGTGATCTCTTTCTATGGCTGGATCGAGACCATACTGCCTGAAAGATGCTTGAGTTG
GCTCTTCAACCTCGCCATCTGTACCAAGTAACAAAGAAACAAACTTGCTTACTTCAACATAAACAAGGTCGATGCTGGTCAGTAACCAAAGTGTCGCAAG
AGTGTTCTCTTCCAGATAGATAGTTTTTAATACGCTTTTTCCTACCCTCTCTCCGGTTTCCCCTTGGAAAAACAAATCTTCGACCTCTACGCACTATTTG
CTGCTATTCAAATGAAAATCGTGCAGCGCCTCATCCACTAGGTCAATTTTTGCACGCTTTCTAGACAACGTGATGCGGATACCATCTGGTGCAAATTCAG
TGCGAACAACACCATTCGTATCAGGCGAAAGCACCGATCGGATAGTGTAATTGGTAGCTTTAGCTGTTCAAACATGGCAAAGAGTACTACTAGTGCCGTT
GCTTAGTTAAACATACTTTATTTATTAATGACAGTAATAATACAACTGTACTGGCTGCTGCAGTACGTACCAATTCAAACGACAAGTCCGGGTACTTTAT
TTTCGCTATGAACACCAGCCTCGCCGTGCATTATTGACATCGAACACGGGTAGTCCTCTAGAACTTGTGTTGAGCGCGATCCTCGAACTTGCCCTTGACA
TCAGTCGCGCGCTTTGATGACCGTCGCGGCTTTTCCAGCTGTAAATTCTCAATCAGACCCGATGTGATGCCCTGTGAGACCATGCGGATGCTGCAGTAGA
TAACACTGGCCCAATCCATGCGTTCTTCCTCCGAGCGAGTTTCCAATACTAGCTTGTCCGAGGGCGAACGCGCCACCACAATGCACATCTCGCGTCCTGG
CATCTGCACTAAGTTCATGTAGCAGCCGTATAGCGAAAAAGACTTGCGGTGCTTGAGTTCGGCCGGGCCCTTCTTGCTGTCGCTCTCTGACAACACTTGC
TTGTAGTAGCGGATTTCACCGTTTGCCACAATGACCACACGCTTCTTCCAGTTCTCAAAGCCAGAGCGAGACTTCTTAATCAGCACACCACGCTTAAATG
GCGGCAGAAGGAATTCCAGCTGAAGCGGGAACGAGGACGAGCGCAAGCTCTTGCGAGCCTCCGCGTACGTGCTTCGAAGGACACTATGGCCCTCAATCGA
AATCAGCTGACAACCCACAGCAACCGCGTAATTGTCCGGACTGGATGCCACAATGAGAGCCTCCGTGCGTTTCTGCATCTCGATAGTAATATCTTCAGGT
CGTCGGAAGAGCACACTAATCTTGCCAAGAGGGATCTCCTCTGCGCGCTTCAGCACGAGAGATAAGCCAGCCACGGTATCTCTCGTACCTTCCATCCTGC
CTAGTGCTGTCTGCGCTTCTTGCAACGCTTCAATCCATAAATGCATCGAGTTTTCATCACGTGCATTCAAGTGCATCTCAAACGTGCCGTCCTTAGACGT
CAACACAAAGTAGTAGGTCCGTCCATCAGGGCACTGCGCCATGCCAGGACTAACAATCGTGTCGTTCAGCGGCACCGACCCCTTTAGCACACTCTGGTTC
TCCGTGTAATACCTCAACTCACCCTTTTCAATCCGAAAGAAGCGGTTTCTCCAGTTCTTGTTGACATGTCCTCTCTTGAGCAACAAGCCTTCCATGTGAA
TATGCGATGTAGGGTCATCGCAGTGCTTCCATTCGTGGTTGATCTTCGTATCATGCACGTAAACCTTTACCGTCTTGTTCAGCGGATCCCATGAATCCGT
CGGAACTGCTCCAGCGGCATGGAGTCGGGCAATCCACTTTTTCATCATCGGCTGTGACGGTGCCGAGATCATGAGG