Description :
From Genome Similarity Track
Location :
Scaffold_156:6837- 9981
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_156-abinit-gene-0.49Cysteine desulfurase 1, mitochondrial
Pytve_DAOMBR484maker-pve_contig_156-fgenesh-gene-0.0Adenylyl cyclase-associated protein
Pytve_DAOMBR484maker-pve_contig_156-fgenesh-gene-0.1Transmembrane protein

Sequence
3144 bases(100 bases per row)
CGCTGCGATGACTCGCTTGTCGTGTAGCCCCACAATACCGTGATTGATCGGCGCTGATGATAGGGGAGCGCTTGAGTTCATCGAGGCGAGGAAGCGCAGG
AACACGGCCTGCGACTCAAGCTCCGCAGCTTGGACTCGAAGTCGACAGATCTCGTCCTTTCGACGGTTGTCGGTGGATCTCCGCGTTATTCGCGGCGGTG
GCGGCCCCATGGGAGGCACGTCGGCGTGACTGCCGGTCGACGCTGCTTTGGTCAAGGGGGGATCTGCAATGACGGCGTCCAGGGTCGACAAGACTTGGCC
CAGTGCTTGGTTGGTGGTTTGCTGGTTTGTCGCACTGTGCTGACTCTGTCTCTGCACTGTCCGCACGGCATGATTACACCCCCAATGTGTTTACACCTCT
CGCGCAAATTGATTGGTTGATCTCATATTTGATATTATGTAATATTAGCAAATCATCAGCGTGAAAAATGATGAAAGACAATGACGATTGGTAGAAATCA
TCGCGCTTACGCCACCTAGTTGCAGTATAATCAGGAAGGGTGGACCGGCAGTTGCAGCAACTCTCGGATAAAGCAGACTTGCCCCGGCAGCTTGCTCACA
ATTCGAATCACCACCACCTCACAATGACCGATGTCTTCCAGCCTCTGCAAGACTTCATCAACGACGTGAACGCGCGCCTCGCCAGAATAGAGGCTCGGCT
CGGTCTCCTCGAGATCGACGCGGCAGAACGCCAAACAGCCACCACACCCACCGAGTTGCCGCCGATGCTTGCTGCCTACGACGAATTCGAGGCCCACTGC
CTGCCACCGTTCATCGCTGTTAGCACCAAACTCGGCGGCGACTTCAAGATGATCGCCGCACTGACAGAGAAGGCGTTCGCGGCACAGCGAGCGTTCCTTG
TGATGGCGAGTCGTTGTCGAAAGCCAGAGGTCGTGAGCGCAGCACTCGTCAAGGAGCTTCAGGAGTGCGTAGTGGAAGTGAAGGCGATGCGCAACTGCCG
CAGCGAGCTCCTCAACCACGTCAACATGGTGCGGGAGGGGATCGAGGCGCTCGGCTGGGTCTGTGTCGAGCGCACGCCAAGGCCGTTCGTCGAGTCGTTC
ATCGAAGGGATCGACTACTGGGGGAACCGCATCCGCGTGCAGTTCAAGGCGTCCGATCCGGACCAGGTCGAATTCGTCGTCACCTTCAAGGAGCTCTTCG
TGCAGCTTGAAGCCTACATCAAGACGCATCATCTCACGGGTGTTGCTTGGAACAGCAAGGGCATCGACTCTGCATTGTACTTGTCGCGACCAAGCTCGAG
TTAGTCTAGACTTAAATCAACATCCTCAGCAAGTGAGTGCACTCATCTATTTGACATCGACGGCAAAGCTCAGCAATACCCTTCCCAGCTTAGATCGTGC
AGTCACCGGCTCTGGCATGTCCTTTGATTTTCTCTCTTCATCTTGTTTCATCCTTGACGCGAATCGTGTGCAAGACTGGTGGCACCTCGATCCATTGACC
AAGATCACACGGTCACGGCGGTACTGGACACAGATAACAATCCAAGTCCGTCCTTGTTGTACAAACTGTTGCTGTCGAACACCGCGAACGCGCACAGACC
GCCGACCTGCATGAGGTGCAACGTTCTCGGCGAGCGTGAGGATACAGCGAAAGGCAAATTGCGTGACATAGGTCACCTTCAAGAGTCCAGACGACGTTGA
TTGCACAGCTCACGACAGAGAGCTAGTGTACCTACAATGCAGCGCAGAGAATCCATCGACGCGTGTATTGGGTTCAGGGGTTGCCTTTGTGTAGCCACGA
TCGGGTGGCGGCATCCAGCACAGTAGCGCGAACACGTGGCCGAGATTGATTAAAACTTCAACTGTGCCACCTTGCGGACACTCCAACCATGCAACAGATC
ATACCGTCGCTGCTGTCGCAGCCGCCGTTGTTCCTGCTGCTTCCGCCGTCGCTACTGCACCACCACCGCCACGATCGTGGCCTTGTGAACGTCTGCCGTA
CCCTGAATGGAGCGTCAGCTGCCAGCACAATGCAAAGTGCTGATTGTGCAAAGCAGGACCAGCCGCCGATATTTTGAACTAACACAGAAGCGATACCGAA
AGATCTCTAGTGCGGCATCATGCTCCCGCTGGTCGGGGAACGCGCTCGCACCCATCGAAACCGCCGGGAGGGACGTCAGTGAAGAGGATATGTGACAGCA
GTCACTTCGACGTCTGTGGCCGTTGACAACATCATGCCATCATCGCTCCGCTCCTGTCCCCGCCGTTGGCCACTCCACCACCGCGGCCTCGCCACCACCG
GCGCGATGGCGATCGGTCGAGCAGTTGCCGTCGTCACGTGAGACCGGCCGGAGTTTTCTCCACGGGCAGCTGATTGCTTCTGAGACGATCGAGTCACGCT
GCTCTTGCCATAATAATCCAGTTCGGCGTAATCAGTCACCGCAAGCACGCTCTGAATACTGCCGTGCGATTGGCAGAAAGTTCGCGACATCTCATCCCGC
AAGCAAAAGAACCTCGTTGCACCCGTACCTACCGGTAGATTTTCACTTGATCTCAGTATGCTCGCTACCGTTCTGGCCGGTGCGCCATCATCGCTTCCCG
TCGCGCGGTTTAGCAAACGACGCAGTTTTGCTATCGACGGCCAGTCGATCTCGCGAAGGGGTCGGGCGTCGCGTGCTAATCTCGTCGCGTTGCCGTAATC
CTCCCATCGCTCGACTTCGCTACTCGACAAGAACCAATATGCGATGGCGGGAAGCCGCCGCCGCTCCTGACGGCGCTGCCGATGGAGCTGATGGAGCTCC
AGCGTCGCCGCCTGTATCGCCGCGTGCGTCCCCACCTGCATCCCCGACGCCGCCACTCTCGACCGCCTCGTTCGACGTCTACAGCGTGGCCACGAACCCG
CCGAGCGGCTCGTCCTACGACACGTCGGCTCGCGCATTGGCCCACCGTGAGATCGCCACGCGCTTCTTCGGCCCCATGTCCTTGTCTCGCACCGCCGAGC
CGCGCGAGGAGGACGAGGAGGACGAGGAGGACGCGTGGACGCTCAGCTCGCGGTCGGACGGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAC
GGCCGCGCACTACATCGGAACCGGTGCTGCCGCTGGCTGCGACG