Description :
From Genome Similarity Track
Location :
Scaffold_237:6836- 8250
Sequence
1414 bases(100 bases per row)
CCCAAGTTGTATCTTCATAGCCAACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTCAGTGGCGTTCTGTCGTCGAGGATGGCCTC
GACTTCATATTCGCCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTACC
AACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCCA
GCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTTTTCGTCAAGCCCGGTTTGACGCGTTCCATGTA
CAACAACGCCCGGCTCCCAATCTCAAAAAATGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCTGAAGCTTCTAGGGGTGTTCGTTTCCACTTG
GTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCCTTGGCCATAGTGAG
GGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTC
GACTGCGCATCCCAACCATGAAGGAGGTAGAACGGCATTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCCGCGATTTCGT
CCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCT
CAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCTTATTAATGATGGGGCT
CCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTATACGAGCACT
GAAATAGGAGCAACGCCGTGTTGCCCCTACGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGCACGTTACC
AGGTGAGTATCCACGAAGCTGTGAACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCGATCCAATAA
TAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCG
GTACCACAAGCCGC