Description :
From Genome Similarity Track
Location :
contig_29:683486- 684842
Transcript NameFunction/comments
g5883.t1endo-1,3(4)-beta-glucanase, putative

Sequence
1356 bases(100 bases per row)
GCCATGTACAGCGCCCAGGAGCGAGAGAGGCCGTCGTCCATCTTGGCCTTCTGGAGCACGCCCAGCGCGCGCTGCTTGTCCACCATGGCGAAGTTCATGT
ACAGCAGCGACAGCCACGAGTTGCTCGTGTCCTCGCGCGTGACGATGGTCTCCTTGGCCAGCACCTGCTCCCACTCCTCCTTGACGAACTGCTTGGTGCG
CACGAACTCGGTGACGGCCGACACGGGGAGCATCTGGATGCCGTGGATGCAGTACTTCTCGGCGCTGAACCACGTGGCGTAGTCCACCTTGTTGTCGAAG
AAGATGCCCGTGACCTTGTTGGGGCGGAAGTTGGCCGGGTGCACCTGGTTCGCGTCCTCTATGAGGAAGTACGTCTTGATGGCGTGCGCGTTGACGCGCG
TCATGAGCTTGCCCACGGCCTCCATGGCGGCGTTCTTGGTGGCCTTGCCGTACATGTACATGGCGAAGGCGAAGTTGACGTCCTCGGACGTGCTCTCCTG
GTCCTTGCCATCGGCGAACGGCGTGACGCCGTGCGAGTACGAGTGGCCGCGGAGCCAGTCGAAGGAGCGGAAGCGCGCGAAGAACTTGTCGGCCGGGTCG
GAGTTGGCGACGTCGCGCACCAGCAGGTCGACCATGGCGTTGAGCTTGCCCAGGTCGCTCCAGCTTGGGTCCAGGCGGTTCATGATGGCCGCCGTGTGCA
CCCAGTAGCCGTAGTGGAAGTGGTGGTCGTTGTACATGGTGTTGCCGAAGTCCGAGTTCAGGTCCTTGGTCTTGAAGCCCTGCGAGCTGACGATGCCGCC
GTAGATCTGGTCGTACTGGAGCTTGTTGGTCCAGGCGTTGGTCACGAACGGCGCCATCACGCCGCGCAACTTGTTCAGGCACGTGCTCAGCAGACTCTTG
TCTCCTCCGGCGACAGCGGCGTCGTTGGCAATCAGACACAGCGACGCGTACTTCTGCGCAGCCTTGCCGTTGAAGTAGTAGCTGCCGTCGAGCGGAATGG
ACCAGGCGCCGTTGATGTCCTCGCGCAGGTGGTCGGCGATCCGCTGCTGCTGAGCCACGCTGGATGCGACCTTGCGCGTTGGGTAGAAGTCCTCGGGAAC
TTGCTGGGTCTCCTTGATCTCCCAAACCGGGTCGGCTGAGCCGCCTGGCGTCAAGAGAGCTTGATAAGCCCCGCGGGTTGTCGAATACGCCACCATGCCG
TCCACTTGACGGACCCCGTTGCTCTTGTCAATCGTCTCGACATGGTGCTTCATGGCGAAGTGCAGGAGACCGCCGGAGCAATCGCCCACCGTCTTCCACT
TGAACGAGTACGAGCTGTCGTCACGGAGATCAACATTCGCCGCTTGCACGATACAG