Description :
From Genome Similarity Track
Location :
Scaffold_5:683404- 715624
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04550avrblb1 secreted RxLR effector peptide, ipi01
Phypa_INRA-310PPTG_04551hypothetical protein
Phypa_INRA-310PPTG_04552hypothetical protein
Phypa_INRA-310PPTG_04553hypothetical protein
Phypa_INRA-310PPTG_04554secreted RxLR effector peptide
Phypa_INRA-310PPTG_04555hypothetical protein
Phypa_INRA-310PPTG_04556hypothetical protein

Sequence
32220 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTCAGTCTGGTTACCTGCTTCTAATTGCCCCACAGGGAGCGTGCAACACGCTCCAGTTCCGCAGCACCAACCATTGGTGCTTGTTGACGAAAGCCGCTGA
TGATGCGGCACACACGCAGTTGTATACGAAGTCCAATGTTTATGCGGTCCTCCAGCATCCAGGAGTAGATGTAGGTAGGTCGTTGTCTGCACGTCGTCGC
CGTCGACTCTGGCAGCAGCATGCGTCTTAGTCGTCTGGTACAATCCCCACACAGTTAAACTTCGCTGTATACTGCAACACTAGCTCATACTTCATCCAGT
AGCTGCAAATGCTTCAGTGGGTAGTTGGGAAGAGGTTGCAGGCTGATAGTGTGGAGAGGGTGGAAATAGGCAGGCTTATTAAGGAGACGCCGGCTCGGTA
ACCAATTCCGGTGAAAGTCCTGACCTCGAGCTTTATGTTATCGTCGGATCGTACATGTCTCTACTACGACCTGGTGGTTTGCCATAGTGATCGGAAAAAT
CAGGTGAAGTGCGAAATATAAGATTCTCCATTCTCCATGTTATCTAGTACTAAGCAGCACCAGCAGATTCTGCTGTGCTTCCTTGCAAATGATTTGAATG
TACTATCTCGTAATAGTGTCCAGAATTATTCTGATCTTTGGGATTCTGTAGCAGCTGACAGATACAATGAATTTCATACAGACGATCCCCTCGGTGGTAA
TCCCTAGAAATTGAATACTCCCTCAACAGCAATAAATTAGTGGTTCCCGTTGACCAAACTGGCGTTCATACCAGGCTATTCGAAATGTTAGTCTTATAAG
TAATTTGATGTCTTATCGATAAAATACGATATTATTGTGTATATCTGAATATTACAGCTGCGAGTCAGTTGGACTCAATTTGACAGTTAGATCCGAAAAT
AGTGCGGCTTAGACTAATTATGCGCTATTATTGCGAATACTCAATTGTTCGCTGCATTTAGTGTTGTACCGTAAATATCACAGATATCCCAGCTACAAAT
CCATGCTTCGCGAAAATCTCACTTTTTGCGACTGTGGCCTCGTGAACACAAGACATTTCGATTTTTAATATTTCTAAAGTGTTTATGTGCTGCCACGTCC
GATCCGAATGTAGAACCAATGATGCCTATTCTTTTGATTACGGAGAAGTGCTCAACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGACAATGCGCTCGCTATTGTTGGTCGTGCTTTCGACGCTGGCCGTGCTCCTAGCAGCC
ACCGAAGCTGTCTCGCCCAACGCTCCCAACCTCGAAGCCGTGACGAAGAATCGGAAGTACACCCTGACGTCTAAAATTCAACCATCGCCGGCTGAATACT
CCGTCAATGAAAAGAGAAACTTGCGGACTGACAGCGGAAACATGGGCATGGAAGCTTTCAAGACAGACGATGAAGAGCGACTCTCTATCTCAACTATTGT
GGAGAAAATAAAGGCCTTTCTCTATGGATTGAAGATCGGGTTTTCTCCTAAAACAGAGTCCAAGCTGGTGCTGCGCTTCGAGGAAAAGTTTTTTACCAAG
ATTTACAATGCCAAAGAGACGCCTGAAAGCCTAAGAGCCAAGTATATGGGTAGGAGAGGCAATGCCTTTTTCGAGAGATTCAATGCCTGGTACAAGAAAA
AGGTTGCTGCAAACGAATTGGCGCCCAATTGAGGATGACTATACAAGAACATTTTTTTTTTTTACTGCGCGATCAATATTGCCGGGGAAAATTGCGGCAA
ACATGTTTTCTTCGATTGTGTATACCACGTCACAGAATTGCAGCCCCACGATGTTCATACAAGTCGAGCGATTTGATCAACAGACAACATAGCAGAGTAG
TTAAAAAAAAAAAAAAAGAAAAAGAAATGTAACACGTTGTTATCATTCACCTCCCGCAGCTTAAGAAAGGCGATCCACATGTGTGAAGGGGTGCAATAAG
TTCCTGATGTAACTTGCGAATCGGACATTATAGCGCAGACAACTCGGTATACGTACCAGAAAATAAGTCTAACACACATTTTACCTTCGACCCTTGCCTT
TTTCTTGTGCTGAAAAATACTCACTCGGACCTGGGAAAACCAAAAATGGCCATCAGTGTCGGACGGATCATTCTAATTGTTAACTAATTACTCACATCAC
GACGCAAGCTTTATAGTTCTGGTAATCACAAATTAAGGGTATCCTTAACTTGCCTACTCTAACGGGATCCTACAAACGTTTCATTAAAAATGATCACGGG
CGGCGAAAGGAGACAATTGAACCACGAGATGTGATGCGTTAAATACTCCCATGTTGGCATGGAGATTATGGTAAGGTTTTATCCTATTTAGGTCCTACGG
GCCATAATGGGACCAACCAAAAAGCACGATGTATTTAAAGACGACCACGCATCTCAAACTGATCCAAAAGTGTACAACAACGAAACATGTCAAAACGAGC
GACTGTAAATCGTGATAATTCTTATAATAGGATACAGGAAAACTTGATTTATTAAATTAAAAAGCCAAGTGTTTATACTTCAGGAAAACATTTTAACCAA
TAACCACTAGACGTTTTAAACCCCGACGTATCTGCTTCATATAAGTCGCATGTTTAATGTAAAGTAGGCGTCCATTACAAAATAAACCTCCTTAAAATAT
ATTAATTTAATTTCAAAACATAATAAAACATTTTAGCATAATGTTTTTTTGTGCTTAACTCCCGGTTAAGTTACGAAAGTGTCTGCATGGACGCGGACAG
AGAGCTCTTCATCCAGCAGCTCGTGGCGGCGTTGCAGGAGAACACGGCGCTGGCCGGTGGCGTTCCCTCTCTCTCCCCACGTTCTCCTGGTGCTGCTGAT
GGCGGTTCTAGCTCTGACAGCTCAACAGAGGGCGAGAAATCTCCGCAACAGTACACTGGGCTCTTCCTGTCCGAGTCCTACTCAACCCTCAGTGGAAATA
CCGAGCGACTGGCGCGAAATGCGTACAAGCAACTGCAGTTCGACTTTCCACAGCTTCAAGAGGCGTCAATCAATGCACTCGCGGAGCTCTACAGACGCGT
ATCAGCTGAGAAGTCGACGCAACTTGTAGCTGCCGAGATTCCAATTACTGCCACATTACTGGACGGTGTGGCATTCCTGAACGACCAGAGCCCGTCCTAT
GGCTCAAATGCAACACAAACACCTCGCAGCTCGGAAAGCAGTGCGCTACTAGCAGCGTCGCTGTTTCTGCTGGTCTTCCGCTTATGCTTGGAGTCGCCAG
AGGACCCACGAGTGGAAAAACTGCTGTCATCACTGGAGATCAAACGATCGCAACAACAGACCAGAAAAACCGAAACTTCTAGCAATAAACCAGTACAGGA
GGAAGCAGAAAGCGAGCTTGAGGAGAAGTATGCGGCCCAGGAAGACCCAGACGACTTGAGTCAAGTATACGAAGGACAGTTACCAGAGCCTCAAACTCAT
GTTATCCCCATGTGGAACCATCAGACGTCAGCTATATCGAGTACTTTAAGGATCGATAAACTCCGATATCTGGTGTCATGCACGTTCTCCTCATCTTTTG
AAGGTGTATCCATGGAGAAGTGGGAGCAGTGGCGTCTGGAGGACGAACTCGTTGTCATCATGCGACTTCTAGTCGGTCACCCACCTGAAAACGACGACAA
GATCGATGAAACAGAGAAAGACAAGCGCAATACCTTACCTGCCACACTTTATGGTCCTATTGGAGAGTGGAGCAGGTACCTGTACGTGCTACGAGACCGA
GTTCTGCGCTTCCCAGGCGCCAGTCGCAACGCTTTATGGCGCCTGAAAGAGCTGATAGAATTCCTCCAGAGACACCAAACTGCAGCGAATCCGCATCACG
GTATCCAGCCGCAACATTTGTTGTATCGCGTGCTGGCGGAGCTGGCAATTTCTCGAGAATTCCATCAAAGTGGCGCTCAGCGTGCACAACAAGGTCTGTC
GCTGGTTATCCAAGAACTATTGCCATTCATCACGCAGGAGATTCATCAACTTGTACAGGTATCAAGTGCTGCAGAGGCCGATGACGGTGACGAGCTGGTT
GTTGTGTTTCTGCAGCTGCTGCACTTCATGCTCTTTGCATCATCCAACGCACGTACGACCACCGAGAAACTTCACGAAAGCGGCATGTTGCGAACTCTCC
TCATGCTTCTACCAGCATCTGATACTGACAAGACGCAAGCTGTGTATCTGGAGAAACGCTGGCTCCCAGCACTGCTGCGTCTTCTGGGCGAGTGTGCGCT
GTGGCATGCTGGCTTTGCTGTGTACATTTCTCGAGTCCCGAAGTTCGTTAAACTACTTCCGACATTGAGGGAGCCATTTGTGGCTGAAGAACTGGTTCTC
GGTCTTGCATTTCACCAGCATCAAGTGGCCATTTCGGTGAAGATGGACATTTGGGGGACATTTGTGTCCGAGTCATTATTCCCGCTAAAGTGCGAATCGT
ATCTTGATGCGATGAAGAAGGTAAGCAGACAATTAGTGGGGGTCGAATGGGTTTACTCTAACGTGTTTGTTATTGATGATAGCTTCAGGACGCCGTATTT
GTATTGGACTGCTTGGAGAAGGCGCTTGTAGCGTTACGACCTGCGATGCAGAAGGAGCTACAGCGCAGTTTACAGCCGATCTACATTGGTTTTGCGCGGT
CGTTCGAGTATCCAACGTTTGCTGCTGCGGAGGCAGCTCGACAGCAGGAAATCGCGCAGCAAGCGTTGAGTTTAAAGGAGGAGGATGACAAGGAGAAGAA
GGAGGAAGATCGTGGTCAAGCGGAGGCGCTGCAGTTTACGGCGCTGAGGAATAAACTGCGACAGAGCGTCAAGTCGCTATTGTCTGCGCTGTCATCGGGC
TTCGTCGGTGGTCGCGCGTCTTCCAAGTTAGACTGAGAATTAGATCAAGATGGCTACAGTTTTGTTAACTCGCTAGAAAACGTGTCCATTTCTATTTCAA
TGTGATCCCAGCCAATTAGAATTCACGGATACTGTAATTTCAGTAGTCGACCTGTCCACTTCAACAGTTGCGCTCTATTCTGATGGGTCCATTTTCATCA
GGAAAGTTTTCTATTAGGTGACATACTGGATAACCTGAGATTCTGGTTGTATTTGTACGGTAAGGCCAACTTACATGTAAGGCCAAGTCTCTGAGCCAGA
AACTCTGGCCAACGCTTGTTGCCTTAGGTAACCATCGCCAGCAACCAAAGGCGCGTTGGTACCGCTGGCAGCTACCACTGTTAGTGTCGAGCTTTTGGTG
AGACCTGCAAGGTTCACGCTTTCACGCAAGCCAAAGAACGTTGCACAAACGTGATGGAAGGTCTCAATACTCAGTGACACGCGTGATATTTTCTAATTCC
TTGTCCGGTGCTGGCTTCAATTAAAAATTCAAAGTTACTTGCCTTATCAGGTTGGGCGCTTTAGTTGCAAGCGAGGAATCAGTGATACGTGGCAGGTGCA
TTGCATTTCTCATTAAATAATTACGCTCAGAAGCTTCCAGTCCTGCTAGATAATCGATTCTACATACTCATACATGCTACAAGCTAGCGCGGTGACGCAA
ACCCCATACTTAGAACAAACACTCGAGCAGATCCTTCAAGTCCTGGTCCGAGAGAGCTTGTGGGTCCGTCGGCGTGTTCAGGAAGGAGAACTGTTGCAAC
TGCTCATCAACGGGAGCCAGGAACATCATCATGTCGTAGTCCAGGACGGGGAACTCATCGCAAGGCGACTGCATGGCCATAGTGGGCGACACAACCTTGA
CTGTCTGTTGCTTGGTTTGCTGATAATGCTGTTGACGCGAGCTGCGCGCGTTTGCCGGGAGCGGCACCGAGCGGTGCTGTGTCTTCATATGTCTCGTGAG
GTTACCGGCCGTACTGAACGTCTTGCCGCAGCCTTCAACGACGCACGTGTGGATGGCGTTGCCATTGTGCACCTTTTGGTGCTTGGCCAGCATGTCCTTG
CTCGTGAAGATGCGCGTGCAGCCAGCCACGGGGCATTCCATCCTTTGCAGCGAGTGTAGACGTTTGTGACGCGCCAGGTTACCGGACGTGCTGAAACGTT
TGCCACACGATTGGATAGGGCATTGATGAGGCTGCTCACCCGTGTGCGTCTTCATGTGCTCATGCAGTGTAAATTTGCGGTGGAATCGACCACCGCACAT
CGGTACGGGGCACGCGAACGGCCGGTCCTGGTGCGGGTCGCGGATACGTGGCTGGCTCATCATATTGGTGGGACGGATGGCGGTGCTTGCAGGCATTGAC
GATGTGGTACTGGTAAAGCGGTTGAAGGCGCGCTTCAAATCGAAAAGTGAGTTGAGACTCTCAAACCTTCAGAGCAGCTCCGGTCGGTGTCAGGCTCGGA
CATACGGCGCCGTGATGGACCCTATCCACGCGCTGCAAAAAAGCTCGAGCTTGTCAGCGCATCTAAAACTGGATCGTCTCTTGTCCTGAGAGCAGTGTGG
AGGACACATCAAAAGATAGCATTGAGCAATACGGCGATCGCCGAAGCCACCTCAACGTCGTGTTCTGCGTCGCGAACGAGACGTCCAAGGCGCGACTAGT
GCTCTTGAATCCAACATTCTTGAAGGATTTTGCTGCAGTTTGGCACTGCATTGGTTCTCCAAGCAGAGATCATTTAACCAACACTAGAAGCCTGTATGAA
CAGCAGAAATCGCATCGTAAGTGGAATGAACTGTACTCGGCTCTTTTGACATGTTGGAAGAATAGCATGTCGCGGTGGTATCCGTCCAACTCTCTCCTTC
GAGCAACGTGACGGCAAACCGCAACGGCAACAACACAACGTCCTCAACTTGCAGGAATCCACCGAGTTGCTCCTCCCGATTGCGATCTTCTGTCGAGTCC
TGCGTAAATCATGTCAATGTTCCAAAATTGGTTGGTGCATTGGTGAGACCATCGAAATCGCGACACGAGGCATGTGGTGCACCTCGAAAAAACTTAAATT
CATACTGCCAGCACCTTGCCCATTCATGTACACGCGAAACGCAGCTCTAAGCGAGCTCTTGGTCAACATTGGATGGCATATGCTGCCGCATAAGTATAGC
TTCGCCGTCTGGCAAGGTCTGCAAAATTATCGCGGTATACAGATTGAATATGGGCAGTTTACTGCACGCAGGTTCGCACAAAATGCCCGTAATCTGCAGC
ACGCACCAAAAATTGAGTGTCGACCATTACGGTCACCCCAGAGCAGACAGCCTGGGGTTCGCCAAAGCAAAACAGCGCTCGCTGGGCAGATATCCTGGTC
TACACAGATTCTAACGCGAACAGCGCCACAGAGAGAGCGGAAATCAATGTCCTACGCATTGTCATTCCTCCGTTCGTAACAGCACAACCTTCCAGCTGTC
GGTCTCCCAAGATCAAATAGATGTAGCTGGTTGTCCGACGTGCGTGCCCAAACACACTTGCTTGGCTGGCACGTTGAAGCTGCACAAGCTCCGCTTGGTG
AGATTGCGGCTGCTCGCATTGGCTTTGCGCTCCAAACACCGAGCAGAGAAAGACTCACATGCGGTGGCACCATCCTCAACGCTTCAGTCCGTTTGAGGGA
CGAACGCGAAGCGAACGCTGAACTCCATGGAAGCGTTCAGCAGAATCTCAGACTCCAACAGCACGACAATAAAGCCACACTGCGTATGGAGCGTGGGTCT
CGACAGTGAGCCACCACTTGACGTGTCTCGATGTTTTCTACTGATTTCGCGGCACTTGGGCCGGGCAAAAATACCGTGGTACCCCGTGATAAGACCCATA
ATCAGAGCTATGAGAGCTGGGACTTCGAAAACAAGGCTTGTTGATCGTTGCAAGCACGTCACTGTGGCTAAGACGACGTATAGTGCCGTCGCTGCGCTGA
TCAAGCTCGGGTAGGAATTCAAGTGCGTCGTGTTCTGGAATATGTACCTGGCTGTTTACTGCGAATAAAACAGCCTGTCTGACAGAGGGTCCTTCTCTGG
TCTTGCACTTCAAACTGCATCGGGTACCGGAATATGTACACTGCGTTTACCCGATCCCGGCCGCATGGAATTTCACGCTGCGAGAGCCATCTGCGCTGCG
ACTTGCAACTGGTGCACCAGCAGGACCTCGCAGATTGCTACTCGACAGCAGGCGAAGCGAACGTGATCCTTGTGTCGGCGGCGATCAAGTTTGTAGCCAT
GTGTCGGTGGTCGTCAGTTTGTTACCGGTATTATGGGATCAGAGACAGGTCGAAACGTCGTAAGAAAGATCGCGAGTGCGTGTTTATTGCACTGCGTGCA
CATCGGGCGTGTTGGACGCTGTTGCACCAACCAGCAAGCAAACAAGAAGAGATGAATGCGATACTCGTTGTCCCGAACTATTGGAATATCTGGTCAGGGC
TGGCTGGATGTCCGCGGCTGTCCACTTTTGAGGGGGATCTACTGCTGGATGTAGCCTACTGGAAGCTGCGGGTGATGAATGTTACATGTACTTAACCCTG
CCGTTTGATAGACTAGTGACGGCTCTCACGGTACGTCCTACTGTAGACAATAACGCGTAGTGGTGATTCATCCCGCGCTACTTTATCTTAACGTATCGTG
GTGATGACTTCCTCTTTAGAAGCTGCTGAATGCCGTACTGCCACTGCCACTATTTCGCGTAGCCATCTCATTTGTCTTTGCAGCTCCGTCAAAAGCGGCA
ATGTAGCCAATTGCAGCCTCCAGCATCGTAGCATAATATCCAGTCTCTCCAATCATCAACGCGGTAATCATCGTCTCGCTGATCAAATGACGAGCCACGA
TTACACTTCGCAGTTTACAGCGTGCCAATACAAATATAAAAATCGGCAGGAAATCGTCTGCAGCCATCGGCGTCGGCTGCACAGACTTCCCCTTCCTGTC
AGCTTTGAAGCCATGTTCTCTCGCGTGGGTCTCGTAAATACAGCGAGCCACTTCCACGAGGACTGCGGCCTTCTCTGACGGCAGCGAATAATTATCCATC
GCGTTAAGTAAAGACACAGCAGACTTCCACTCAGTCGGAGACTGATGTGATGGCTGGATCTCAAGAAAACTCTGCGGCTGCGCAGCTACGAGTGCTCGAA
GGCGTTCAAAACGTTCCTCTTCTTCCTGTCTTTGGCCTTGTGCAGCCCCCAATAGCTGGTAAATAATCTCCTGCAAAGGGATGAATGTCCGTCGCTCCAG
TTTGTACAGCGCTGCACGTCGAGCTAGCGCCCACTCATCGTCTGTAGGTGCTCGCTTCCCATTCATAGCAGAGTCTCCCAGTTGTCGAGGCGTGTTCGGG
TCCGCCACGGTGTTAAGATGCTCCATAATGAGCTCCAGTGATCGTTCCAAGAAGAATCGATAGTTCTTTAATGCCAGAAGACTGCGAGCGTCCTGCAGAG
TCGTGACGTTATGGAGTTCTTGCGGTGTTGCACCCAATGATCCCTCTCGAAGTTCCTGGTCGCTGTCTGACTCGTTTCCACTCAGTCCGGGCGCCCACGG
CTCCGATAGCCGCGTCCAGGCTGACGTACCTATCGCCGCTACCGAAGAAGCGGCCGGGTGTTCATATTTCTGACGAAACGTTAACAAGAAGCTGGCTATA
TGTTGCCGCATAGTGAAACTCGCAAGGTACTGATCACAAGTGCGTAATAACGAACGCAACGTCGGGGACGCAGAGCTCACAGCACTCAACACTCCACCTG
GCTTTGCATGTAGCGAAGCCCATAATCGCAGCACATCACCACTACCTCGAGACGCGCTCAAGTCGTCTTCTTCGTCGCTTAACTCATCAGTAACTGCACC
TCCATGAGCGTGACTGATTGCACCCAAATTATCACGAAAAGAACTGCCATCAAGCGCCAACGCCTCTGCACTGAGCAGTCGACGTTGAGCTACACTCTCG
CGTAAGTCAAAGTACGGGCCTGGTCTTCCCTGTGGGTGATACGAGTCTCGACACAGCAGAGCGTCTTCAATACAGTACATCCAGTTCTCTCTATCACGCA
GTTGAGCCGCCTGCAAAAGCAAAGTATAGTCTGGACCCACTTGAATGGCAAAGCTGGCATCACGACCACCAGCCACATGCACATCCACATAGTGAACTCG
AGTCTGTGGATGGAATAGCAGCACTTCGCCTTTAAGTTTCGTACAGGAGGAGTCAGCGTAGTACCGCAATACCGATTTTTCCAGCACGAAGTAGCGCGCT
TTCCAGTTCTTACGAACGTGTCCGCGTTTACGTAGCCAGCCGCTCATAGAGTCCAGGAAGGCGTCATCGAAGGCACTTGAGGACGTACTACTGGATAAAC
TACTACGACCCGAACGTAAACGTCGATAACGTACCCATTTCCGTCGACGGACTCGCAGTCTTTTACCTGAAGAGCTGGCAGGGGCTGAAGACGGTATTTC
TCCACCTGTTTGGGACGGAGATTGACTCAATGAGTCAATAGATCTACCTCTTGAGCGGAGTGATGGTCGAGGAGTGAAATGGGAGAAGCTGGATGCGTAT
TGCCAGCCGTCGACTGCATTTTTTGGGCTGTTTACGGGGATTTCCAGATGCCAGGGACTCACCCACTCCCATCTGGGGCCCGTTAAGGAGCTCCCAGAGA
CGGAATTCGCAGTGTTATGAGCTGCAAGCTGTCGAGCGGCCGTGGAAGCTCTCGAAGCACTTGTAGCGGATCTGCTACGCTGTTTAGTAGAGGTAACACC
AGGTTTATCAGCCGATGGAGGCTCAGGAAGTGAGATATCTGGGAATGTGGAGGACGGGAACCACTCCAGCAACACGTCTTCCTCTTCTTCTCTGCTGTGT
GAGCGTCGTCTTCGTCTCGTTATGGAATGACGCACTACTCGCATGTATTTATCGGGATCTAGAGGCAGTAAATGGCCTTTAGAGCCCCACCCCAGCACCA
TTTGATAGCGTTGGTGTTCGTACACTTCTTCGGCCACGATCACGGGCTTTTTTCTCTCTGCGCGACTGCTGGTGCGCTGATTCTGCTTCTTATTGGGCTT
TTTGGGGACTGCGAGCCGTGTGGGGGCGTAGAAGCTGCTGTCGTAGAGTGACGAGGGCGGAGGGATGTCCAGAGACTCCTGTTGGGGGAGAAGCGTGTGG
CCACGTAGCTCCAAGAGGCTCTTGTTGCTGTCCAGGATGCTGCTGTTGCTGTTACTGCGGAGACTCAAGAGGAAGCTGCTGGCGTCCAGACTACGCGTGG
AGGAGGTCACAGAGACGCTCGAGACGGCGCCTGAGCGAGAGGAGGAGGGAGTGCACGCGACCGCCAGCCAGTAGGACGCGTCACGTGCACTCACGGGCGG
CCCTGAGTCGGTAGGCGGTAGCGACGCCATCTTGCCCGCAATGGGAAGCTTGAACTGTTCTCAACTAGGTTAAACAAGAGAGCAAATGAACCAATCACAA
CACGAAGCGGATGTACTTGAACGGGAGGTTGATGAAGTCGTACTTAAATGAGATATTGAAGATATGTTGAAGTGGGAGTGATGGTCTTTACCGCTGCCTA
AAAATAGTCGACGGCATTACTTTTTTTTTATTTTATCAAACTACTGTAGCGAAGATGACACGAGCAGCAGCTTGGAGCTCTTGCAGTCGTGCGCTTGATG
AACGAATACACAAGTCTCAGTGGCAGGCTCATCGCGATCGGGTCGAGTTTATCCAGTCATCTAGTTCTGTATCAGCTCAGGCCTTTTCCTCTGCTCTTGC
GGCTTCTGCACACCCTCATCGCATCCACAGCAGTCAGAAATCCTCAACCACGTCAAAACTCGATAGACGTTCAAAATCAGCGGCAAAGGCACGTCAGAGG
CAAATCGATCATGACAACCTCGCTTTAATCAAGACGATCATCGAACTCGACAATGCGAATTCACGCCGAGGAACTAAAAAGAAACAACCGATTCAACCAC
AAGATGGAAAACACCCAAAAGCTTCGGTGTTTGCAGACAAAAACACGATCGTGGTGCCGGAACGAGCTCATTGCGATCACGAATGTCTACATCCGTTGCC
AGACGTTCCACAGACACCAGCTAGTCATGTACTCTACACTCGCGCTTCAGCCACTATGAAAAATAATTTTGTCGAATACAATGCACCAACAATGATGCAC
TCATCGAACTCAACTTCGGCCGCGGCTCGGGTGCGATCACGAGCTCAATCAAAAATTTTACACGAGAACAAGAAGATTATTCGGCGAATCCTCAATGCTC
GGACAACAGTCGATCGCGCTGCGTTGGAACGTCATGAAGAGAAGCATTTCAAACTGCGCACCATCATGTCGCGCCATCGGTTAGCTTCCAAAGCATTGCG
AACCCCACACAGGCAAAGCAGAGATACTAGTGTTGCTGTCGTACCTTTGGACACCGGCACTAACCACTATGATTCAGCAATTCGCGTTGACCCCATAAGC
CACCTTGCTCAGCAACCAAAACATCGTCCTTGCTCCGCCCCACAAACCGCCTCCAGATCAAGAGCTACGGCATCAATACATTCTGCAAGAATGCTTGACA
ACAGTGAGGCGTTGATCTCGAGAATAAGTAAGATGACGATCGATAATCAATGTGAATAAATGCATTTTGAAAAATATCAATTACGTTCGTGCATCCTTCA
TGCTAGCACTCCTTCATTGCTGAGAACACTCCTCATTGGGTGGATGAGATGCAGAGCCTCGTTGGACCGACGAAGCGAATTCATACAGGTGTTGGTAGGA
CGGCATGACCGTCACATTAGAACTGATCTTTTTTTTTTTTACTGTTCGGACATAAGCGTTGGTACATAACTTTTGAATTGCTTTCAAAAGCGGTGATTCT
CGGAGTATCCGATGAAAGTTAGTTTTTTTACAGGACAAAAATCTCATATTGTCCTAATGGGTCTTGTAACGTATTGAGGAAGCTTAGTAAATGGATAAGT
GAATTAATGTTTCAACACGCTAAAGGCGTAGACCTCTGTAGGTCCTCGTCCTCCACCAATTTGCTCACTCCTATTGTTTACAGACACATGTACCGCCACT
ATACTCCACATATTAAATTTGCTAATTGTATGTATCCCACTGCAGATCATTTCTATGATGATGGTACCAGTTTGCTCTGGTAATTATTAATGAGAGTGGT
TGCTGCTCCAGACTGGTATCATAAAACAGCCAATTTGCCGCTGTTGGCAAGCATTGGTACGTAGCTTCCAGCGAGCGTTGAGCGGGTGCTGTAGTATGAT
TAAGGGCACTAGTGGAGATGCTACTCGATCCTCCAAACCGAGCAACATTATGATCAAGGGGAAGGAAACAGCGTTGTTGCGTTTTCGGGCGGGCCCTAAG
TTGAGTCTCTGTACAGAAATAGCCGTTATTAGGCCATTAACAAGGGCATGTATTCCCTTATTAAGGACAACAGATGGCTCCCAGTCTGGAGCAGCAACAC
GTGCCATTATTAATACCAGTGGTACACTGATTAGTACTCGTACTTATCAGTGAATCATGGAGGTTTTGAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAATCTAATCAATGCCGAGTGAGAGGGAAATGAAGGC
GTTTGGTGGTTTGCTGGTCACCACTACGGCTGTATCTCCGCCGATTGAATCTAACACTCTGGTCAGCGGTGTAGGGAGAGCATTCACTTACTGTTAATGA
ACATTAAATACGAGCTGACAGCCTTTCTATGGATCTAATTCCGCGTGAACTGACGCCAAAACAAGGAAAGGTACAATAAATAGTATTTATTTATTAAATA
CTGGTTTCAAATCATGGCATCAAATCAATAGCATGGCTAATTACAAACCACTGATTTGTATTGTGAATTCCGTCCAAATTTGCCGACTTGGGTCTGTTTG
AGGAGCGGGTGGACAATCGCCCACATACAAACCCAAGTCATTTGTGGAGCCCACCAAGTCTTTTCTTGCCACCTTATTTCGTACTTAAACGGGTCAGTAT
ACGGAATTCGCGATTTGGGGAAGATTCATTCAAAGAACTGTCCTGTCCAATTTTGAGTACCCACTAGGGATGGGGACGTAAACTGCTTTAACGTAAATTT
TTGCTTGTTCCCGTTCCCGTCAAAAAGTTCCCGTTGGCGTTTTTCCTTACGTACATTCCCGTACAAATGACATTAAGTTGAGGAGGTTTATTTATTTATT
TTCAAAAGTGCCGACCCAATCGCCATAGTTGGCGACACCAACAGCAACAACTACAGCGGGCGCAGCTCCACGCGTAACTGAACGGGTTGGCCTCGAGTTT
GCGCATGCACTGCCGTCTCACAGCGTCTCGCAACCGTCAATCTGTCCACAGCAAGCAGCTACATTCGGTGGAAGCAAGAAGAAGCCTGCCAAAGATGGAG
TGTGGGCCTATGCCGTGCGGACATCGTCAAGTTCACTGCCAACTTCGAGATCGAGCTGGTCCAGCAGCGTCTGGGAGCAGTACATGACCTCCACGTAGAA
CTACAGGTGGAGAGCACCAAGTTCTACATTGCTATTTGGATTCAATCACGACAGGAGGGTCTCTCTTGCGTCTAAGTGACCATGGCTAATCATCCGCGTC
GCTGAACGTGGGTCTAAAAGTTACTGCAGATCAACCATGGCGTCCACGGGGCATTATGAAAAAAAACTTAAATGGAGATATCACCAAGCAGCCCATGGCT
TGGTTGTGTTTTTGGACTCTAAAAGACTCACATGAATACTGAACTCGATCGCTGCGAGCACTTCCAGTGTGAATCGCCCCATGATGTGATGCACATGGAC
TACGGCGACTTCCTCTGCTGCCTTGGCCAATACTTGTTGGAAGCTAATGCACTTTTCTGGAAATCCTGGCCAATGGACATGATGTGCTACGTTCAACTCG
TTAAAGCACAGACCCCTCCCCTCAATAACCACGATACAATGCCCACAGTTTGAGCCCGCACTCACTCCACGGACGTAGCACACACTTCACATTGCAAAGT
CCACACTCGCTGCCCACACTACCAATCTGTAAAGACCTCACCCACGACACTGCACTCCAGAATCGCTTCTCCACAACTCAATAGGACCCTGAACACCATG
ATTCACACTTAGTACTCGTCCACCTTCGCCCCGTAGCACTCGTACCTCGCGATTTCAGATCTTGTCAAAGTCTCAGTACTGTCAACTGAAACCTCTATTT
CAGAATTAGTTTGTTTATTCTCTATAGTGGGTTTGAGATTGACGTTAAGTTACGTAAAATGTACGACAAAATTCTGGCCCAAATTTTGTGTACGGGAACT
TTACGTACGTTAACGTCCCCATCTCTAGTACCGATATTTCTGTGGAACTCATCCGTAGGTTCTGTGGATTTGCTTATTCTGTCTGTGCTATTCTCTCAAT
AATTACGTGGGCATTGAAGGAGTCAACAAATAAGAGAGCGTGTTCGATGCACTGGTACATGTGATGAAAAAAATACGTAAGGTTTAGGGGACAATCAGTC
CCCTTTATCAGATATAACAAGGTTACAAAATTGCGTAGCACACGTAGCTTAAAATTTTTGGAGTCTACAAGAATTCAGTAACAACTACAGCAAACCACTA
CCCCCGACAATCGCTTCGGCTTAATCCCTATTGAATTATTGAGCAAAGGTTTCACCTAATTAATGCTGATTGTATTAGGCTAAACGCAAGTACAGTCGGA
TTCGTTTTCTACTTTGTAGACGTGGTATAGTGGTACGTCCACATCTGGAATCTTTTATTAGTACTAAATCAGTTACCTATTTCATGAATTAATAAATCAT
TTTCAGCATCTTTAAGAAATAAGTGAAAACGTGCTGGTTGGAGAGCGATATCATATTTACTCCATTCATTAGATAAAGTACTAAATATCCGAGGATATTA
ATTTTTACTGGTTCGATTCAGACAGCGTGGGAATGTTATTTTTACCCACATGTTTTGCCTATCCATCTTGTCACATTAAATGGCAGCTCACGCGAACTCA
CGGTGAGGTTCTCCCACAAGCACCGTTTTCCATGGCCAGATTAATGGTGAGCCCCTCACTTCGCAATTGAACATCCCCAGTTACGATGGCTATCGATTCC
AAGCGCAAGTTGTCTCATGTCCATGTACTGTTGGCTACTCTAGCGCTACTGATCTGCGCCAGTGAGGCATTGAGTGTTATTAATGCCAACAAGCTAATCC
GCTCCAGTGTTCCGTCCCGTCGGCGTCATACGTTCGGTAGGCGCTTGAGGGCGACGGTAGATGATACCGACACCAATTACGACTTCGAAGATAGAGGCTT
CACCGGTATCACGAAGATAAAAGACTTCACTCAAGCTGGAACGAAGAAACTGCAGAAGCTCGCTGAGTCTGCCAAGACGAAGTTGACCTCCAAGCCCACT
GTTGACCAAAGCTTCAAGCAGTTCAAAGTTCATAAAGTCAAGTCGAATGTGTTCGAAAGCAAACAGTTTCAAGCCTGGGCCAAGTCTGTAGCGAAAGCTA
CCAAGAACAATCAGGACGCAGCTGACACTGCGATGCTCGCGACGCTGGCGACCCACTATGGCGATGAAACCCTTGCAAGTATAATAGATGCTGCAAAGCT
GGTGACGAGTACAAAATCGATGGCCACTAGGCTGGAGAATATGCAGATAAAGCAATGGATGGATGATGGGGACGCACAACTGAATAAATGGGCGGCTGAT
GGGAAAACTGGCGACGTCGTGTACAAGTTTTTAAGGATTGACACGGAAGGCAGTAATTTGCTTAAAAGTCCCAAGCTGAAAACGTGGATGAATTACATGA
CAAAGCTGCACAAGGATCCATATGACGTTCTACTTTACAAGCTAAAACCGCACTATGATGACGCAGGACTAGCGAAAATGCTTGTTTTGTCCAAGAAAGA
TTCAGCAGCGAAAACGGTCGCTGAGAAGTTGGAGACGTTGCAATTTGAAAAGTGGAAGAACAATGAAAAAAGTGTGGCCGACGTTTTCAAGTTTCTGAAA
TTAAATGAAGACAGCACGACACTTCTGAAAAACCCAGTGTTAAACACTTGGGTCGCTTATGTGGAAAAGTTGAACAAGAACCCCTACGAATTGCTGTTTT
CGGCGATCAAGAGTAAGGGCTTCGACGATGTTGAGTTGGCGAAGCTGATCACTGCAGCGAAGCAAGACATGCATACTGGGGCAATTGTTGGAAAACTGGA
GCAAGTACAATTCCAGAAATGGGCGAGAGATGGGAAAACCAGTGGAGATCTCTTTAAGTATCTAGGGCTCTACAAAGCAGGGGACAAGTTGCTTGAGAGT
CCATTGTTGAACAATTGGCTCTCCTACATGCAAATGCTGAGGAAGGATCCCTATGCGCAGTTAGTCTTTACAATCAAGAAGTCAGGCTTCGACGAGATAG
ACTTGGCAAAGATTATTAATACGGCGAAGCAAGACCCCAAAACCAGTGCTCTTGCTGGACAAGTGGAGAAACTACAGCTCGATAAATGGTCGGCCGATAT
GAAAAGCAGCGAAGATATCTTTAAATTTCTTCGACTTGACAAAGAAGGAGACAAGGTGTTTGAGAGCCCAGTATGGGGCACTTGGGCCGCTTACCTCAAC
AAGCGGGAAATTGACCCAGATGCAGATTTGGTGATGTTCAATATTCTGAGAAACAAATTTGGTGACGAGGGACTAGCAAATATGGTTACGAAAGCGAAAC
AGGTTGAGAGTACCAGAGAGGTCGCCGAAAAGTTGCAGCTGGAACTTTGGCGTGCGAATGCACATAGCTCAGATTACATTTTCAATCTTCTCAAATTGAA
CGAGAAGGGCAACAAGATTCTAGAGAGTCCGGGGCCATTAAGCACGTGGGTGGCTTATGTGCGAAGGGTGAACAGCTTCAATAGCAACCGAGGAAAATTC
CAACCTATCCTACTGTTGGAGAAGCGTTTCGGAGAGAAGGAGCTAGCACAAATGTTTGTCAACTCGAAATCTCGACACTATGCAAGCAAGCCCGGCATTA
TCGAGAATTTGCAAGAGTGGCAATTCAAAAAGTGGATGGTTCAAAAGAAAAAACCCGGTGACGTCAATAAGATGTTCCCATCGGAAGACCTGACCAGCTT
GCAAATTAAATATGAGTTCAAGAACTTCTACAAGGAGAATGTCGACACACTGATGATTTAGACAGAGTCCAGTTCCAGTTTTGATTGACTAGCTAGCTTT
AGAGCTTCTTAAATTCAGTACCAGCCAGCACTTAAAATGTTTTGGTCGTGCTTCGGCGAGACCAATAGCTTTTTTGCATGAACAAGGTCGTTGTTGCCCA
GAAAAGCCAAACAAACTGGTCCATGGCATCACAGTAGAAGGTGGAACTAAATGACCGCCAAATGCGTTACAGGTTGAGACTGGGTTAAGTATTGTGGTAA
GCAGTAGAAGCAACTGAACAGGATCCATAGAATACCACAGCCTTTATCTCCTATTAAACCAGGACATCGTTTGCTTGCCAAACCAGGCGATGCGTATTGC
GCTGTATTAACTTACTTCGCATGTTAACAGAAGGATACATAGCAAACGTAACTTGAATGGCATCATTTCGTACATGTACAAGTTTCGGCAAAAAACAATG
AAAATACGCGACTCCATTTTACTACATTATGTACGTATACTTGTTGCAGCTTTCTTTTCATTTTATGAAGCAGGGTATTACGAGTATTCTTCGAGAATCC
TATTTGAAGACTATGACGGCTAAGGAGTATGTGATAGTATTGTGAAGAAAAAAAGAAGAATGCTGCTGGAACTGCTTTTGTAGTCAAAGGAAGAGTATCT
GAATGAGATCTGAAGAAGAATCTTTGGCAGTTTCAGTCTCTGACGATGGGGAAACCTACGCTGTGGATATTTCGAGGCGGTAGTTGATGTTATTTAAAAA
TTGTTTCTCAGTCGATGCAACTTATTTGATGTAGTCGATGTCTCTGCTGAAAAGTTCTAACAATGCCTCAAATAATCGATCAAATACAATATTGGATGGC
ATAAAAAACTTGGCTATATAGAAGTTTGTCTCTCAATAGGCCCAATACTTCGATTTCATCAAAGCTATCCTGTCTACACCGCAAGCTGACGTTGGCCGCA
ATGCTGTGGTAACTTCGGGCGGAATTAGCATTACGCCAATTTCGATTCGAGAATGTTACTGCCACACTCTGAATCATGATCGCAACGAAAAAAAAAGATA
TTTGCATGCACAGTGTAAGGCGCAGACGGCCTAGTGCTCACCGTGTCTCTGCCTCTGTAAACAGCTACATTTTAATCATGCGGCGACGGTAGAGACTACA
TCTACGCTTACGGCAAGCACGGTAACGACTCCGTTGGGCTTCATTGTTTGTATTTAAGGTGTAATAGGCTGAGAAAAAGCTCTCGACGTGACGGACGAGA
CTATAATCATGAGCGACAACAATTGCAGGCACTGCTGGTAAGATGTTCAAGCACAGTATGGTCCTCGGTTTTACGCAATGTGGATCGAACGTAACACGTG
CTTAGTAAGCGTTTCTAAAAAGCGATGACAACCATAACCTAGAGGATACCGATACGTAGTCCAGGCCCAGCAGGATATAGAACGCTTGTAAATTCAAAGT
AACAACAGCACCAAAACGTCACATGAATAGTATTTTTCAATGAATGGAACTTGGCTGTCACGTAGTTAACTAACTAAGGACGCCCGATGAGCCATCCCAA
TCCGACCACCCCTCCTGGTCTCGCAAGACCTGAAGATCTTCACATTCAGATGTGGCCCACATCAAGTGCTCGAGGCCCCCGGCGCCTTGGGCACCTCATC
ATACAGATAATAACTAACTAGTAGATGTAACATGTATTTCATTATTATAGTTTTGTACTATTGAAAATGCTCTGCTGCAAGATGATAGCAAAATTACTAC
TCACTTGTAGAGAGTTCAATCTGCTGAAGCCTGATATTCCAGTTCTCACTTCACCTCGCTGAAGACTAAAATGATCGCTTTGTTGATTTCGCTTGTGCAT
CCTTGAGATGATGCGGACTGCTATCACTACTAGCGGACTTGAATTTCGAGAGATTGTCTTCATTCGCGTCCTCAGCAGCGTTGACTTCGACGCAGCGTAT
GATGGTGGCGATCGCCACTAAAACAAAAGGAAGGCTGATTCGCATAGGTAAGTTTTCTTTACTACTCTGTCTCCGAAATGAGGAGGCAGCAGTTGCTTCA
AGTAGTCGCTGTAGTACATGGTCGTACATGTAGGATGATTGACGATGAAGATAGTCTAGACGTGATTAGCCCCCTTAAATGAGACGGGATTATGTTCGTA
TTCTGTCATCTTGATTGATGCAGGCCGTTCCGACAACGTTAGCGTATGCCAATGTTATGAGATTGCAGCAACGTTCGCTTATCCCAGGATTATGTTCACT
TTGTAGCAGGCCTCGGACAATACAGTATTATATTGTACAGCCTTGATTATGTAGTACATAATCAATTGGATCTGATCTGAATATGTTCCGAATACATACT
GTTGACAGCGACCAGACTCATGTAAACTCCTCTAAACTTCAAATACCCGTTTAAGTAAAGTCAACCTTCTGAGTATCAAACGATCTCATTGGAGAAAAAT
CGCGGATTTCATCTGTTTCCGACACTTGATTTCTACAGGCGACAGTGTTGTGATCTGTGGGTCGCTTTAATTGTGGGAAATAAAGCTGATTCCCGATAAC
ATCCCTAAGTAAACTTAAGTGGCGGATATTAACAGTTATTTTGTTTATAGGTTAAACTCGTTTCTTTTTTATAGTGCGTTCTTCTTCCAGGAACATTCGT
GATGTGAAAAGAGTCACACGAATACTACATGTAGCTGCATTGCTAGCATTTTGAGTGCATTCTGTTTGTTAGTGATTGCATATTTAGATTTTGTTCAACG
TGTATCTAGCAAGATGATACAATTATCATCCGTCAAGAGATTTGAAGCAGTGCGTTTAATGGAACGAGAAGCACTTCTAAAGAGACCATATAGGATTCAT
AACAACCTGAGGAGTAGACTAAACTCCATTCCATCTAAAGAGAAAGCTTCAACAGTACAAATGGGAGGATAATCGCATTAAACGAGTTCTCTACATTATA
CATGCAAACAGCCACTTAGTAAGAAGCAAGACCCAAAATATAATTAGGTATAATTGCGTACACACCTTTCAGCCAGGACTCTACGTACGTACTGCACTTT
AGGCTATATAAAGCTACCTAAATGACTCCTCCGATCTTCAAACTCGTACTATTGATTGATGATTCAATATCAATTGTTTTATAGGGTATTACTAATTTTC
TCTTCGGTTTGCGGCAATGAAATATGTGTAATTGTCGTTGCTAAGTATTTTTTACACGTCATTCAGTGGGATACAAACTCGTAGATGGTTCGTTTCTTGC
TACGATAATACTCAAAAGACACCGCAGTAGTCGAGCGTGAGAACGGGGTGGTCATCGGTTCATTTCTTGAACAAGGCATTAAACAGCTTGAGGAAGGCAT
TAAACAGCTTGAGTAAGTGAAGCTTTAATTCGGAGTAATTATTTCGATCCAAATATATCAGTTTCATTTAATGCAAAGTTTCCAGCATGTTCTTGAAATC
AAAGCAGCGGGTCTTCCCGCAATTAATGCTATTATGGGAAATAGGAAAAGCCATTTGAGACTGCGTCAAACAAAAAGTTACTAATCAACCATTAATTAAA
AAGCGTCTAAGGCACACCTTTCAAAAGCCCTGTATCTCTGCCGTCCGTAGAGCCCTCAAACGAAGAAATCCATTCAGCCGTTTCGGATAAATCGGCTGAC
CAAAAAATTATCTCCGTCAAGGACGTCGAAGTGGTTTTTTTATTGGTGAATTAGATCCAGAATCGCCCAAGGAATCCGGTGGTGGCCTCGGTTTACGCTA
ATTCGTACTCTAAAAGGTCAGTTTTGCCAGTTTTGTGTTGCCACTCCAGTGTACCCAAGTGTAGTTTTAATTTATTTTTTTTTGAAAAATCGGAAATCTA
TACACTGATGGACGTAGGTATCAATTCGATTTATCGGGTAAATTGCATACTCTGCCGAAGCACTTACTTCTTTGGGGCCTTCCTCTTCTTTGCAGGCGCT
TCCTCGGCGCTTGGCCCGACGTCTTCGTGCCCACGACGGTCCTGATTCGCTTTGCTGCCACTACCATGGCCGCACGGTGGTCTCGGCGTGCCTGCTTGGC
TGCTTTGGCATCCAGGTGATCTTGCGCACTCGGTTTTGCGTACAGTGGATCGTCTCGGAACTCCTCGGGGACGTATGGCCTGGTGTTATGGTACATCGTT
TGGCTTTCTCCACATTGGGCGGTGGTGGGACCAGCACCTCCACGTGGTCGCTCATCATCTTCACCACCTTCTCCTTCGTCGTGAGGATACCGTCAATCTT
ACGCCGGAGATTCATCTCGACGGGCTCATCGCTAGGTTCCTTCCTACACGACACTACTCCAATCGACACTTCGTCCATGGAGAAGATCTGATATTGCTGA
ATGCCTTCTAGGCGTTTGTACAGCTCCGTCAGCACGCCCTTGTACGTCTTAAACTGCGAGCTACCACATGGAATGTGAACCCTCACAGAATTCGCCGCGG
CTTCCTTAACAGCGTTCACTACGTGAGCCACAATATAGCAATCTTCTTTCGCAACGTGCTTGCGAATATGACTCTTCTTCCGGTTCCCTGGGGGCGACCG
GGGCAGCAACAGGAGCGCCAGTGTCGGCACGGTGGGGAGCAGCTTCACTGCCGCCAGCAGCAGCTCCCGACGCGTACGCTGTTAGATCCTCCATGGTCGT
CTGCTTTGTAGGTGATACACCTCGATCCAAATTTTTGAAAAGTAAAAAAGGCTCTTACTCAGCAATTCGTTTATGTACGAAAAACCGTTGGTCAACTTCA
GAGCCGTTTATCTCGAAAACGCTAAAATGTTGATTAGTAACATTTTGTTTGCCGCAGTCTCATTTCAACCCTATGATGGGCGATAATCACCATCCGAAAA
TTACGTACTTGTCAAGTACGTAGTACCTCATAACACTGTGACGACATAAAAAACAACCGTGACGTTAACAAAGATTACAAGCTAACACCTAGGCCACTCA
TTCATTCTCGAACTCGCCAAACGCCCCACAACCAAGACCCAAGACGTCAAACTACACTCGCCATTTTCCAATCTAGCAAGTGCCATGCGCAGCTTCCTAC
TTCTCCTCGTCCTCGCTCTCGTGGCAATTACATGCAGCAATGCTTTCATGTCAAGTCGTCCCAAGCTTAAGGTGTCAAAGCCGGAGCTGGATCAAGCTGT
TCAGTGGAACATCGAAGACAAACGCTTTCTTCGAGCTACGGATGCAGCTGATGAAGAACGCGGACTAGCGGACACTAAAACGAAATTGAAGGCATGGCTG
GAAAAGTTTATTTCATTGTTCAAGAAGTCGAAATCAGCGAAGGCGACGACGACGACGACGACAACGAACTTAGAGGAGGTGGCTGAGAAGGTGGCGATAA
GGTATCAGTCGGAGATGTACAAAAGTGAAGTGATGTTGGCAGAAGATCTGATCAAGAAGGGCGTCATGAATGACGATCTGTACAAGAACAAGATCAGCCC
AGAAGCGTACTTTGACGCGATGAAGCTGGACCCGAAGCTCAGATTCGTTTCCGATTCGGCTGTTGCGAGGGCGAACAACCCCAACTTGGAGAAGTTTTTC
ACGTACTCTCTCTTCTGGACCAAGAAAAATGAGGTCACAAAGGCTGAAGGTCTGATCAAGAAGGGCGTCATGAACGATGTTCTGTACCAGAACAAGATCA
GCCCGGAGACGTACTTCGACGCGCTAAAGCTGGACCCGAAGCTAAGATTTGTTTCGGACTCGACGGCGAGGGCGAACAACCCCAACTTGGAAAAGTTTTT
ATCGTACACTAGCTTCTACAACAAAAGCCAGGCCGGCAAGAGAGAAGTCGCAAAAGCGGAAGATTAGTCCAGAAGCGTATTTTGAGGCGCTGAAGCTGGA
CCCGAAGCTCAAACTCATCGCGGATTCGGCAGTTGTGAGGAAGAACAACCCAGACCTGGAAAAGTTTTACACGTATGCTACCAAGTACTACAATAGTCTG
GCTGGCAAATAAAGCTAGAACTGGCACCTTCTGATACTACATTAAGGACCAGGTCGAAGTAAAAGAGATAATTGAAAGCGATACCACCGTGTTGCATATG
AGCCACTGCAATTGCTCCAGAGTACGATACAGTATTGCACCCCGTTTTCGTGCCCTCGGACCTTTGATAAACTTCTGAATATAATGCTCCTTTTGCCAAA
ACTCCTCGGGTTTTATGCTGAAACCTGATGCGTTTGCAAATCTTAACGGATTTTTACGAATAGTGACCAGTCTTCTATTTATTAGTGGCCCCATGAATTC
GATCATTTTTGACGAGGGGTCCTCTGTTCGTAGAGGGCCTCTATATCCTACTCCACTACGCCAACCTCATCAAGCGCAACATCGATATCGTCGAAACTGA
ATGGGTCCTCACACTCGAGCTCCGTAGTTAGCTCGTTTCCTGCCTCATCACGGCTCCAAGACTGCTCGAACTTCCACCCGTAGACGTCGTGATTTCATAC
AAATCAGCGCGTGGAATCGACATCAAACCGGCAGACTCAATCGAGTTCAGCACAACAGACTAAGGCGTGTCGCGCCGCGCTTCGTGCATGCAACTACGCA
CAGTAGTTACTACAGGAGGCGGGTGAGGATTGACATTGCGAGTGTACTCCACAACGCTCGGTCGCTTCCAAGCGTTGGTCAGGACCGACACGCTGTTCTT
GAATGGTGCTGGTTGAGCGCTAGCGTTGCGGTCTTGTAATCGTAGAGGGTTTCAAATTCTAGAACAGCATCGAATATTTGACGGAGGTCTTTTATTTGTA
AGAGGTCTTTTATTCTCGTAAAAAATCCGTCAAATGGCGAAAACGGGTGCAAAGGGCCGACGCAAAAAATTTAACCAATGATAGCATCTCGTTTCAAATA
CCAATCTTGTATTGGTAAATAAGCACTAAATACGAAACCTTTCAATCTGTATCTGTGGATTACACGTATTTATAAATTAAAGCGATAATGCCTGATCGGA
CAAACTCTCAGAGAGTGTATCGCTTTACTGTTAATTTATCGATTTTTTCTTCGCCCTGGTCCTAACTATAATATCGTTGAGAGCGTAAATCCGTTATTCT
TGAGTGACAAAGTGAAGAAGACGTTATGAATACGTTTGCGGTCTGTGGGAAGACTTCATCCTGCAAAACATTGTGAGTTGCAAAAGGGCCTATTCAGAGG
TCATGACTTCCAGCGGTTTTTGCGGATCCGTTTTGGAATTTAGTGGATTGATCACCTTGCATTTTGATTTCCTAAACATGTTTGGCGGACTAGTGTCGGG
TGCTTTCAGAAACACACATTTATCATGAAGATATTCAGTGTTAACTTCACCCGTCGCCCCATACGTAACCTTCGCCTCCCCTGTGCGTCACATACAGCGT
ATGTCTGCCTATTTGCTTTGCCCTTGGAGTATGGCCAAGGTTATCGTTTCCTGTCATGGTTATTACCACAACCAAGGCTTGAAGACCGAACCTCTAGATG
CCGTTCCACAAGAACGTGGCCAGCAGCTCAGCCCGATCACCGCGCCAGTGCTCATATGGGACCCAAACTTGATTCTTCTTAGTTCAACTAGAGACGCAAG
GCTAGCTTTACTTCATTTTCAATCTCATTCTCAATTTTTCCTGACAGCAACAACTTCGAGTCTCAACACGACGGAAAACGTGACACCTACCAGAACGACA
GATTCACATCGAATACGCTAGGTATGACACTATTGAAGTGTCGCCGTTCTTTGTTTATTAATTCCCTCCGCGACTCCAGGTGAAGCTACCCTTGTAGCGT
GACGCAGCTTGTGGCGACGCCATTGTTATTTGCTGCAACCGGACAGCTACAAAATCGATTTTTGTTGAGGGGACTGCAGTGTGAAGTGGGCGAGAATCTA
ATTTAGATTCAAGTGTGATTGACTTTTAAGCGTCCCTTGATTCGAATAAATGAATTTGCTTTATTCTGTATTGAGGTCTGTCGTCAGAGCAGCGTATAAT
GCACACCATTTGCATATAATATATGAACCAATTGGCGGTGACCCGGGTCACCAACTATTATGAGAACAAAATCTGAAATATTTATTTAATTTTAGCACCA
GGTATTTCTGTAACGGCTCGCGTTTGGACTGCAATCCTTCCACTGTTGGCTGAAACGAGCGACCCTCCTACGATAGAACGACGAACTGGCGGTACAGGTG
GCTCGAGCCAGACTGCACCACGGAAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAGTAAAATTTGAATCCGTCAGGA
CCATCTAGATTAAACTTCTTTTCATCTGAAAAAACTGTATAAATCCAAGTTTCTAAAGAAAGCAAATGTTTTTAGAATACGAAATAGCAGCACAACCTAA
ATATGGCAAGCTTACCTGGCTTCAGTATGTACTCTTCCGCCCATTGCATACGAGCAACCTTGTGCGCTGCCGCGAGGGGGAGCGTGCGGTCCATCTTGGT
AAAATCAGATGGTCCACACGCTGCAGAACCCGCTGGATCGTCCTCACGGACGCCTTGATGCCGAGCTTGGTCTTGAGCTCCGAGGCAAAGAACTCGCCTG
TTGCCGCAACACGCACAAGCTGCCGCAGCTCTCGTTCCGTCAGTGCTGGTTGCCGCCCAGTCCTTCGCTCTCCACCGCTCTCTTCTTTCGGTCCCCGCTC
CGCTTGGATTGCGTTCCGGACGGACGGACGGGACCGACCTGTCTTCCTAGCGATCTCGTCCAGAGAGACGCCTCCACCGTGGAGACCGACGATAAACCAG
TGCTCTTGTTCGGAGAGGGCCTAGCCGTGGCCCATTTGAAAATGAAAGGCTCACAGCCTCATTAGCCTCCAGCTATCCGCTCGTTTCCGCCAACCATCTA
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCTGTTCTTGAATGGTGCTGGTTGAGCGCTAGCGTTGCGGTCTTGTAATCGTAGAGGGTTTCAAATTCTAGAACAGCATCGAATATTTGACGGAGGTCT
TTTATTTGTAAGAGATCTTTTTTCTCGTAAAAAATCCGTCAAATGGCGAAAACGGGTGCAAAACCCGCAGTTAAGCAGTTAAGGGCCGACGCAAAATTTA
ACCAATGATAGCATCTCGTTTCAAATACCAATCTTGTATTGGTAAATAAGCACTAAATACGAAACCTTTCAATCTGTATCTGTGGATTACACGTATTTAT
AAATTAAAGCGATAATGCCTGATCGGACAAACTCTCAGAGAGTGTATCGCTTTACTGTTAATTTATCGATTTTTTCTTCGCCCTGGTCCTAACTATAATA
TCGTTGAGAGCGTAAATCCATTATTCTTGAGTGACAAAGTGAAGAAGACGTTATGAATGCGTTTGCGGTCTGTGGGAAGACTTCATCCTGCAAAACATTG
TGAGTTGCAAAAGGACCTATTCAGAGGTCATGACTTCCAGCGGTTTTTGCGGATCCGTTTTGGAATTTAGTGGATTGATCACCTTGCATTTTGATTTCCT
AAACATGTTTGGCGGACTAGTGTCGGGTGCTTTCAGAAACACACATTTATCATGAAGATATTCAGTGTTAACTTCACCCGTCGCCCCATACGTAACCTTC
GCCTCCCCTGTGCGTCACATACAGCGTATGTCTGCCTATTTGCTTTGCCCTTGGAGTATGGCCAAGGTTATCGTTTCCTGTCATGGTTATTACCACAACC
AAGGCTTGAAGACCGAACCTCTAGATGCCGTTCCACAAGAACGTGGCCAGCAGCTCAGCCCGATCACCGCGCCAGTGCTCATATGGGACCCAAACTTGAT
TCTTCTTAGTTCAACTAGAGACGCAAGGCTAGCTTTACTTCATTTTCAATCTCATTCTCAATTTTTCCTGACAGCAACAACTTCGAGTCTCAACACGACG
GAAAACGTGACACCTACCAGAACGACAGATTCACATCGAATACGCTAGGTATGACACTATTGAAGTGTCGCCGTTCTTTGTTTATTAATTCCCTCCGCGA
CTCCAGGTGAAGCTACCCTTGTAGCGTGACGCAGCTTGTGGCGACGCCATTGTTATTTGCTGCAACCGGACAGCTACAAAATCGATTTTTGTTGAGGGGA
CTGCAGTGTGAAGTGGGCGAGAATCTAATTTAGATTCAAGTGTGATTGACTTTTAAGCGTCCCTTGATTCGAATAAATGAATTTGCTTTATTCTGTATTG
AGGTCTGTCGTCAGAGCAGCGTATAATGCACACCATTTGCATATAATATATGAACCAATTGGCGGTGACCCGGGTCACCAACTATTATGAGAACAAAATC
TGAAATATTTATTTAATTTTAGCACCAGGTATTTCTGTAACGGCTCGCGTTTGGACTGCAATCCTTCCACTGTTGGCTGAAACGAGCGACCCTCCTACGA
TAGAACGACGAACTGGCGGTACAGGTGGCTCGAGCCAGACTGCACCACGGAAGAAACAAAAGCCTCGGAATCGACTGACAGCGTTTGAGCGTGCTTGTGC
TCTACTTGGCACTGAGAAAG