Description :
From Genome Similarity Track
Location :
Scaffold_32:6834- 8473
Transcript NameFunction/comments
Phyca_LT1534117270Hypothetical protein

Sequence
1639 bases(100 bases per row)
cggagtggctttcatcaaattaattcttttgtcacgtggtagagatagccacgctttgcggagagaagaacctcctggacgaagcagccacttcttgtcc
atgcgttggcgatcggcttcagtcaatagagatcgttttctaacatattccttcgcgtagatcgacccttccgcagaggcaaaaatccacaccgcttcgt
gaaccaacatactggcggtaaatttctcaatgctggatttatacgtctcttgttgctcagctaaagatggcgtcgatacgccttcgagatcttatgtgaa
cggtgcggaggtgcctttactttctggcccaaatttgtacgtggcgggtaatgtaaaattaacttttactctagtccaaatttattgttgtatactctat
tgtattacaagatctattagttttgtactggtataaaactattttattttccgttatataaattggtactgatgtgtaagtaatccacttaaacttcatt
acagtaggaatataaagctaaacggttcgatatatgtattttaaaatgtgtatttcagaacgaattacacaactacaagtgatgcggcggtatcctagtc
tccagtataacatacgatgacaacgatgctactgacgacgaagcaaacctcgtacgcaactatcaccgacaatccgtcgatctacatataaatccacttt
ccggatgaacgaaacaccatacacccacgtcaaatcaaagtctgctatacagacggcatggttgtcttcgtcgtaaagaagttttttccccatcaccact
tgtatagtaatacagtggcatacccccagcgaattgaaagctgcacaaatgtatactccatcaagcaagataactgctttcaactttggcgcggcagatt
ttccatttatcccacctaataaattcttgtccagcacttgagtactaatttctctcgcatttgagctcactcgcgcgttagaaaacttcacgtatcgccg
aagttctccatacgtcagtccattttgagatataggccggccacgatcgttacattctttataaaactggtttatcgtagatttgttactccattctgta
ttactaagtaggccagcggcaacatctaaagcgtaaaccgcgcatcttcctttgggcgaggctccaattggacgtccctgtctagagcaatatttgaaaa
agtcaacttcgtctgataatttccacgaatccactatggagcaggcttcactaaaaccatctttccgtagagccgatcctgtttcccaaatatcatccca
tctgtatccatttgggtcgtcacgccatttaaccctgtaccgataccctcgacctgaacgcttcctgtcgactatcgaaaaaaccaatacccgaaacagg
aacacgccatggtttagctgcacttaataacaggagagaagcgtttggaccagtcgttacagatcttcctcgatttaaaacgcgtacggatgccagcttg
tcctcagcagcaagcgctgttttacttcttctctttagccacttctcaagtcgtagctgtagcgctgaccttgaaatcttcttcgcacgatggttacgct
gccactgaagtcgctttcccaacgcccctctgcaacgcg