Description :
From Genome Similarity Track
Location :
Scaffold_5:683224- 688014
Transcript NameFunction/comments
Phyci_300272indigoidine synthase A family protein, putative
Phyci_89756Hypothetical protein
Phyci_24232Hypothetical protein

Sequence
4790 bases(100 bases per row)
CCAGTGATGGGGTTTGTTCGTACTATTGCTGCTGACGGGTGCGTTGTTTGGTGTCAAGACATCTCGACGGACTTGTTGGAGCTCTCGCGGACGCCGGTGG
CAGTGGTGTGCGCCGGCATCAAGTCCATTCTCGACATCCCGCGCACGTTGGAATTTCTGGAGACTCACGTGCGGTTTGTGAATGAGTGGCGATGTTGAAG
AAAAGCGAGACTGATTTTATCCTGTTGATGTGACTTGGTGCTGCAGAGCGTCCCCGTGATCGGGTACAGGACGGACCAGTTCCCGGCGTTTTTTACGCAG
GACAGCGGCGAGAAGGCTCACCTTCGCCGGGATACGCCTCAGGACATTGCGCGGTTGATCTATGAAAGCGAGACGCTGGAGCTCCCGAACGGCCACATCA
TTGCCGTCCCAAACCCGAAGCCAGTGCCGACTGAGGTCATCAATGAGGCCATTGAGGTTAGTGTCCTCGTCTGATCCGCTTGCGGTGTACCAGTTGCAGC
AAGCTAATTGTGTGGGATGTTGTGTATGCATTAGCTCGGTCTTAAGGAGGTCGTGGAAAAGAATATCCATGGCCAGGCTGTGACGCCCTACCTTTTGAAG
CGAGTGAATGAGATCACTCAGGGTGTCTCGCTCACGTCTAACATCGACCTGGTCAACAACAATGCCATTGTCGGCAGTCAGGTCAGTATTGCGGTAATGC
GGAGCGATACCATTTCATGACTGACTCCATTGTTGCGATTGGTTGCAGATTGCATGCGCGCTGTTCGACTTGGAAAACGGCGGCGTGGTAGATCCTACTG
CCAAAGCGGGCGTTGTATATTCCACTCCAAAGGTTAGTTCATCTTCTTTCTCCGGTCGTATTTGCTAGTATGGTCTAACGAAACACCTCTGCTCATGACA
GAAATCATCCTCATCAAGATCCAACGACGGTAAACTCGTGCTGGTTGTCGGCGGCCTAGTCCTAGACATTATCAGCTCGTCTGCGTCACCACTGATCCGT
GGCACCTCCAACATCGGAACCATCAAGCAGTCCAGTGGAGGTGCGATTTCAAACCACAACTTGTGTGAGAGTGATCTCGTGGCTGACTGTGTTTGTTATA
GGAGTGGGAAGGAATATTGCTGAGTGTCTGCATCGGCTCAGGCTGGATCCTATGCTCGTTTCCTCCGTTGGGAATGATGCACCTGGATCTGTCCTCTTGG
AGAACCTCAAGAGACTTGGCTTGGATACCAGTGGCATCACTGTTTCTGACAAGCTGGCTACAGCAGTGTATTCTGCTGTCCTTGATTCAACTGGAGACAT
GGATGCTGCTATTGCGGATATGAGCGCGTTCGAGTCGATTGTATGTGAGTATTACCGGGAATCGAATGAATGTGTGTCTAACCCCATGTCGTTTTTGGCT
CACCAGGAGAGCAGCAGCATTTCCGACAAAACGATTGATAAGGCACAGCTGATCATCGCGGACGGCAACTTGACTCCAAGTACTATCGGAGATCTGTTCA
AACGTAGTGCGCGTCTCGGCGTAGATACTTGGTTCGAGCCCACCTCGGTTCAGAAGGCTCTTCGTGTTGTGGAGGGCGACGGAGTGTCTTCCATGAAGTA
CATGTCTCCGAACGCTGATGAACTACATGCCATAAGTATGGCAATTCGGCAAAAGCTTGAGGACGCAGGTGTGAGCTCGGAGACAACTGATGAGCGCTTC
CCACTAACCAAGGACTCGGACATTATTCCCAAGGAAGATATGACTCGCCTCAAGAATGACCTCATTACAGGTCTGTAACTGCTTGTCATGTTGAAGTTGA
TAAGCATGCTAGCGCTGCTAACGCCCGCGTATGTTTTTTCAGCTCTGCTCGCTATGGCGAATGGCGATACCAAGCGACCTAAGCATGTTTTGGTCACTCT
CGGTAAGCATGGTGTGCTGGTTGCGTCGATCAATGAATCTATTCGTGAGTTGCGGGAGGTCGTGGATGAGTGCGATTTTCCTGTTGAGATTTGGGGAATG
CACCACGTCCATGGAGGCCACTCTGTCACGATGGTTCACTTGCCCGGCGTGGAAATCCCCGTCACGAATAGCACTGGCGCAGGTGACAGTATGGTAGGCG
GAACGATCTACGGCTTGCTGGAAGGATACGATATATTCCAGAGTTGTCACATGGGCATGATCGCCGCTCGTCAAAGTCTTACCTCTGAGCACGCGATTAG
CCCCAACTTGGCCCCTCAAGTGTTGTATTCGGCGTCATGAACTCGAGTGAATACGCATGGAAGTCAAAGGCAAACGATGATGAGTTGTTGTATTTCATGC
AGTAAACGTGCCGTATCCCTCACTAGGTCTTGAATATCAACACGGTTTGCCTGTCTTTCATTTCTGTTTGCCATGATGGCACTATCTATTGTTCCTGGAA
GTCGCTCGCAAACACACCGATGAGTCGGGCAAGCTCCTTCTGCAGGCCGCTGCCATTCTTCGCGACAAACGCCTGCACGGCACTCTGCTCGGAGGCGCTG
CTGGGCTTCTTGGTCAACCTGCACGAGATCTGTAACAACACAAAACGGCGAGATCGACTCAGCACCGAAACAAGAAAGCAACACGATATGCGGCAGAAAC
ATGCAGTAGTCGTACCTCGTAGTCCTCATCGTTCGAGATGTCGTTCATCTCGTACGAGCCCTTGCAGGTGCTTCCGCCGCTGATCGACACTTCGAAGGGT
AGCGTGAAGTTAAAGTCGAACAGGTACCGCTTCTTGCCGCGCACGACGCAGATGCTGGCATCGCCCGTTATCTTCTCCGGCTCCTTGAGCGTGGCCTGCA
GGTTGCCCTCCGAGTAGGTGGCGCCAGTGAACACCTCCTTCCACTTGTCCTCGGCCCACTTGGTCACCACGCGCTCCTCAAACGTGCCCGCCGTGTTCCA
CGCCGAGCCGTCATGCTGCGAAGAAGGCGCCTGCAAAAATAAAAATATAACACACGAACACAACAACCCCATCAGTCCACTAACCAAAAACAAAAAGAGA
AAAAAAAAAAAGATTTTACCTCCGCCGGCTTGGTCTCGATCTTCTGAGGTGCGATGTCTCCAATCAGATTCTTCTCCTCCTTGGACAGCTCGCGGTGGAA
GTACGGCAGCCCGTTCTTGTAGCCGCGCATGTCCTCCGGCAGGTCCGGCTCGTCCGCCACGACGACGGACGATGCGCCGGAGCTCTTGGGCTTGCTGCTA
GAAGTCGACGCTGACGTCGCCTTCTTCGGCGCTGAAGAAGAGGAGGAAGCGGACGAGGTGGGGGCCGACGTGGGCGGGCGACGCGGCGGCTCGGGCTTCT
TGGGGGGCTCGGGCTTCTTGCAGATGCGCTTGTGGAACTGCCAGTCGCTGGCCTGGCACTTGCGCGCGCAGTAGACGGCCTTCTTGCACACGCTGCACTT
GAGCTTGGCGCCGGGCTTGCTGCAGTTGCGGCAGGCGGCGTCGGCGGCGGGCGCCACCTTGGCGGGCGTCTCGGCCGCCTTGGACTTGTCCTCGTCCTCC
AGGTCGGCGCCGATGTCCTTGAAGCGCGAGTAGTCGTTCACGTCCACCTTCACCTCCTGCGTGCGCTCGATGAGCGAGTTGGCGTCGAAGCCGCCGCTGT
CGCCGCCCGCAGCCAGCGGCGACGGGTCCCAGCCCACGTTCAGGCTGGCGGCGCTGGTCGGCGGCACGGAGGACGCCATGGTCAACACGTCACGTCGCGT
AGCTCCAAGTCGCTTCTTAAGCATTTAACTTAAGTATTGGGCTGTTTGGCTGCAGCGGGTGACGTACCCATCGAACTTTCTCGATATTACAGTTTCAGCC
AATCATATGCCAACTCAGTAATGCCGGTACACTGTACCAATCTCTGTGCTCCAGAATGGCGACGTCCTTGCAGGAGGACGACGAGGGCGTCTTCGAGGCG
GCGCTGTCCTTCGTGGACGAGTTCGAGTTCGAATCTGGCGACGCCATGTCCTCGCTGAGCGTGTTGTCTCCCCAACGCCGCCAAGAAGTCCCTCCAACGC
TCAGTATTGGGCTGGCAATGGACGACGCTGCGCAGCCTCTGTCCAGGGAGGAGAAGCGCCGCCGCCGCGCCGAGAAGAAGCGGCTGCTGCGCCAGGCCGG
CGTCTACAGCGACCCGAACCGCGCGCGCAACGAGCAGACGCGCGAGATCGCCTTCCTGCGCGAGCAGATGGAGAAGCTGCAGCTCGACCTGCAGGTGCTG
CAGGCTCGGCAGACGCAGAAGGGCGGCGTGAGGGCGCTGGCTCGAGTTACTACAAGGAAACAGAGGCCGAGTGTGTGGCAGGAGCAAGCCGTGAGGCAGC
GCCGGAGGAGGGAGCAGGCGGAGTGCGATAACGTGCGGCTGAGGCTGGCGGTGGAGCGCCAGAAGAAGGTGGCGGACAGCTTGGGCGTCTTGATTCGGAA
GCGGACGCGGCAACTGGTGAGATATTATGGCTGTGGAGAGCTAGAGGAGGGTGAGCGGCTGCCTAACGGTTGGTGGGGCTTGTGTGGTTGGTGGCTGGTA
GAAGAACGAGTGCGCGTCGCTGATCAACCAGTGCTGCGTCAGCCACCCAGCGATAGCTGTGCTGGACTTCTGCGGCGACGTTGAAGAGTTCCGCGGGCTG
TTTTACCTTTTGGACGAGGCGTACCGAGGTATGGACGCCGTTTTTGGGGCGAACGGGTTGGCGACAACGTCCATTCCGATGGGGGACGTACATATGCGTG
AAGGCGTGGATGGGAAGTACCTTGAGTTCTCCACGTACAAGGACCTGCCTTTCGGGCTGCAAGACACTGCGCAAGCCTCCTGGGAGTACT