Description :
From Genome Similarity Track
Location :
Scaffold_1:683099- 700854
Transcript NameFunction/comments
Phyra_93339Hypothetical protein
Phyra_71039RNA-binding mating protein
Phyra_72779unnamed protein product
Phyra_93343PREDICTED: acyl-CoA-binding protein isoform 1
Phyra_93345GAF domain-containing protein
Phyra_72781protein phosphatase 2C putative
Phyra_727823'5'-cyclic nucleotide phosphodiesterase, putative

Sequence
17755 bases(100 bases per row)
TTGACACCGACAACCATATCCATCGCACATCACGCCACTCGATCGGAGCACCCGAGGAAAGGCATGAGCGACGTGCAATCGCTGAGTGACTCGCCGGCAT
CGTCCGTGGGGCTCGGCAACTCGCTCATGTGGGAAAAGGTGGCGCTGTCGCCCTTGGAGCTGCTGTCCGTACAGCTGGAACACGAGCTGCAGCACGCCCA
GGAGCTGGCCGCTGCTGTTGCCAATGCCAAGCAGAACAAAAATGGCGTGGATGTCAAGGGCAACAAGGCTGCGGGACGCGTGACGGTGGAGGTGCTGGCC
GCTAAGGACTTGACTCTGGACAAGAACGCGGCAGTGCTGGCGGTGAGCGGCAATGCGCAGCCGGAGCTATACGTGTCAACGCAGGTGACGCCGCTGTCGG
CGTTCGAAAGGACCACCAAGAAGCACTTGCGCACGAGCAGTGTGCGAGCTGTGGACAGCTCGACTGTGAGCTGGCAAGAGCCGCTGGTGTATGAAGGTGC
CAAGACCAAGAAGTTCGGAATCAAGGTGTCGCTCACCAGCAGCGCGGAGGTTATTGCCGACGTGGTGCTTGGAGAACTGGAGCTTCGCAGTGCAGACTTG
AAAGACCAGCTGCCACACGAAAAATGGTTCGACCTGAAGGCGCCGGCATCAGCAGCTACGACTGGTGTCACTGGCAAGTTGTTGCTGCGTGTCACGTTCG
AGTACTCGGCGCGCGAGCGCCACGAGCGTGAGGTGGCTCTGCTCCTACAGAAGAAGCGCGAGAACGATGACGATATTGAGCGATACAAGACTACGTCGCG
ACAGGTGAATGCACCGGTGCGGCACCCTGCGGCATTCGGCAAGGAGACGGCACGTGCTGCACTCTATGTGCCCGGAAACAAATTTAACGTGGATGTACAC
CACCCGGGTGCTGTGAGTGTTGCGCCTCTGGCCGATAAAACTCGCATTGTGACTCCGTTTGGACGTGGCGTAGTGGTTTCATTCCGACCAGAGACCAAGA
TGTATGTGGTGCAGATGGACACTGACGCTGCATCGAAGAACCACACGCTTGCGTATTTGCGCCAGAACGTGGTGAAGGAAGAGCCCGACGAGCCGAACCT
CCGAATGCACATGAAGGTGGCGACTCCATACGGCTTGGGCGTCCTGGAAGAGATCCGACCCCACGATGACATCCTGATCGTCAAGACAAACTACGCGCGC
ATGTTCATGCAGCGAAAGGACGTGAAGCTACCGCAGAAGGACATCAGTGAGATGTCAACAAAGGATCTGACGAACGAGGCCATCACACTGGCGGACGCAG
GCAACGAGGAGTTCCGTGAAGGCAAGCTGCAGGATGCGGTGTACAGCTATCTGCGCTCGCTGGGCTTCCTCCAGCGCGTGGACCAGGACAATGCTACTCA
CAAGGAGAAGGCGACGATCATTCAGACCATGATTCGCTGCCACCTGAACATTGGCGCGTGCAAGCTCAAGTTGAACATGCACACGGATGCCGAGATTGCG
TGCACGAACGCGTTGGGCATCCTCACGGTGCTGGCGGAAAACCGCGACGGCAACGTCGTCTCGTGGATGGGGCGTCTGGGCATGTCCGAGCAGCTCATGT
TCGAGGACTGGCCGTCCAAGGCGCGCTTCCGCCGCGCGCAGGCGTGCGTGAAGCTGGAGAAGTTTGTGGACGCCAAGCATGATCTGCTGCTGGCGGTGAA
GCTGAATCCGCGAGACAAGGGGTGCCGCACGCTGCTGGACAAGGTGAGCAAGCTGGTGGACAAGCAGAAGCGCGACGAGAAGAAGGCCTGGGGCGGCATC
TTCGACAATATCGAGGTGTCGGCGTCGACCATCAAGACGACGACCAGCAAAACGACCACTGTGCAGAGCGGTACCGAGGAGAAGTCGATCTTCACGCGGA
AGACCAGAGCGCAGCGCCAGCAGCAGCAGTCCGCTGCCCAGCACGAGGAGCCGTGGTATTTGACCACGCGAGCGCTTGCCACCGCCTCGGTCGTGACGGC
GGGCGTGGCAGCCGTGGCGCTGCTTGCGTTGAAACCCAAGAGCTCGTAAGCAATCGCTCGGGTGTCCCCTGCCACTTCAACCTCGAGTGCTGGCTCTCTC
GGTCAGATCAGTGGTTAGGCAGAGTCGAGCGATCGCGCCGGGGTCTCCACTACGCCCCATCGTCGCCGAAAAGGAAAGCAGCAGCTGCGACTGCGACAGG
GCGAGCTCAAGACGTGTGGGCCTCGTTGCTTGCCTATAACTCGCTCTCCGCGCCTCCGTCGAGCAGCAGCAAAAGTGAAAATGCAGATGGTTTAGTCCTT
GTTGAGTCTCCGCTGGTGCAAAGCTTCCTTTCAGTTACCCCGAGCGGCCACGGCAGCCTGCCTCGGTCTGGGCAAACGATTGTCCTTTGCAAGTCGGTGC
TCCTGCATCTGGACGCATGCACCTCAGCACCTCGTTTCCGCGCCGAAGCGGCGTAGTCACCTCGTTCCAATGATGCCGGCGAGCTTCTGCAGCGCTGCAT
TTGCTGCAGTCACCAAGATGTGTCGTTGCCGAATGCCAAGGGACCAGCTGGCAACAACAAGTTGCCTTTTGGCGGAGTGATGGTCACTGCCCCTTCTGGG
AACGCGTGTTGACGATCCCAGGCTGCCCGCGTCGCTTCAACTTCGCCGTTAGCATAACGCTTCCACCCTTTCTTCCGACCCTCGTTGCGGAAACCCCGGC
GCGAACGACGGCAAGAGCAACAGTAACCAACGCCGGCCCCAGTCAAGTCACATCACGCCGTGGCTCGACACGTGCGTGCGCGGGATTTTTCCGTGAAAGG
CAACCACACGCATGCATCGATTCGCGACCCGAAATTTCCGACGGCGAGCAGACCACCGCCCACCCACCCTCGGTTGCTGCAGCACACCTTGCCGCAGCAC
TTGCCCCAGGCTCGCCAGCTACAGCGTACGGATCCGCTGTAGCTGGGCCGCAGTTTCGCGGCCGGGTTACACACCCGCCATCTCAGACGCGCGGTCGTTG
AAAGCTCGCGCTCGAGCGGGTCTTCAGCGCTGCAAAAGGCTGGGCAATCGCGCGAGGGTTTCCGTCGTTTTGCGCGAAACGCGCTTCTCTTTTGCCTGTG
ACAGGTTGCCTTCGAAAGCGAGAGGACCCACCCACGTTGACTCGGGCGTAAAAATAACCCCCCGACCCACCGCTGGCGTCCGCAGCGGCTTCATTCTCCA
ATTTGCTGCCCCCTGCGCAAGTGGACGACTAGCGGCTCGCGGCGTTTCAGCGGCACTCGCAGCTCCGCAACCGCCCGCCCCGCGCCACCATGGGCCACAG
CGACTCGATGAGCCCCGCCAAGAGCGGCCCGGCCCTCTCCTCCTCCTCCTCCGTGCCACCGCGCGCCCCCCGCCGCGCCAGCGCTGGGCTAGTGCCCATG
GAGAAGCCCGTCCATCACGACAACCCCGTCGAGCCCACGCGCGTGAAGCTGCAGGACCCCGTCGGGTACCCGCCCGCGGACTCGCTCTGGTCGTCGGAAG
GGCTCAAGTCTCGCTCTCCTCTGCTCTTCTCCACCTCGCAGGCGCTGAGCGAGCGCCCCGCGAGCTTCGCGCTGCGTGCTCCGCGGTTGCAGTCCAAGAC
GGACGCCCGCTCCGTACACAGCGCGCAGACGACACCGCCAAGCGAGTCCGAGGACGGTGACTCGGTGGTGGACAACCAGAAGGAAGATCAAGATGAAGAG
CGAGCCAACTCTCCATCTGAGAACGCCGCAGAACCGCAGTCATCGTGGGGAACAGCGCAGAAACTACCTAACAAGGTACTTATTTCTCTCGTTGGCTACA
TTGCTGGGTGGGGGCTTCGTTCTAACGGTGGGTTCGTTGTGGCTTCCATTAATTAACAGGACAACCAACAGTCGGACAACCAGGAGGCGGAATCGCGTAC
AGTGCCGTTGACTCTGGTGCGTTCTATTTCATTTTTTCTACAACGATGTGGAGCCTTCCTTGCTGACTTGTGCTCTTCTTGCTTGTGCTGCAGAAACCCC
TAGACCGCGATACTCAAAGCAGTAACCACCACTCGGCGGATATCTGGACCAATCCTCTCAACGATTTCGAAGAGGCTCCCGACTTCAACTCACACGGTGC
TACCGTCAGCCCCACCACTTCCCCCGACAAGCTCAATCCGCGTGCAGTCCCAAATTTTCCACGACCGAGTGGAAGTACTTCCAGGGCCATCCCCACAAAA
CCCTCTCGTGGAGACAGCAAGACGCAAAGTGGAGGCTTCCGCGTTCCCCCGGGAATGTCCTTGATTGACCGTATCCAAGAGGACTTCCCCCGTACGCCAT
CCCCTGAGTACGGGCAGTTCGACGACGAAGGGCTGGCTGCCTGCAGACCTGCGTTTGGCGGAAGAGAACAGCAAACGCAGTCGGCGTTCGGTCTCGGTGA
AGGAATGGGGCAATTACGGCTCGACAACTACCGCTCGGCTCCGCCCTACGATGTCGGTCGCCGTTCCAGTCACGACTTTGAAGATATGCCCCGAATGCCT
CAGCACGTGACTGGTCCAAGGTTTACTGGAGTGGATGGTCAGCGCCACACCTTCGGCAGGAGCACCAGTGAGCCTCCATTCGGCGGGTCTTACCATGGAG
CAATGGCTCAAGGCTTTCCATCGTCCTACAACATGGGGGTTCAAGGTGTCCAGGGTTACCCCGGAATGATGAGTGCTGTCAAGTCGCGGTGGTCTGCCAA
CGAGGACACGTACTCGTTTCCATCGTCTCCTTTCGGCTTCATGCCGGCAGATTATGCCAGTCCCCACCCTGGACACAACTCAACTCTGCCGGGTTACCCC
GTTGGCTATGCTGGGGAGTTTCGAGGTATGAAACCCACCGCCAAAGCCCGCCCGTCGTACACTCAGGTTGACCACCCATTTTACGAGCGCCACGACCTCG
GTGGCTACGTGCCGCGTCCGCAGATGCTGCACAGGCCCAAGATCGGAGGACCTCGACGAAGCGATTTCGAGTACTTCCATCCAGTCGTGCACTCGTACTC
GTCGAACAGCCTCCTGGAGGAGTTCAATTCGGCACCGAAGTCGGAGAAATGGGGGCTGTCTGCCATCAAAGGACACCTCTTCATCTTCGCAAAGGACCAA
ACGGGTTCTCGATTCATTCAGCAGAAGCTGGAGAAGGCTGATGAACACATGAAAGCCGAGGCGTTCAACGAGATTTTCCCGAACTCGCTTTTGCTGATGA
CAGACGTGTTTGGCAATTACGTTATCCAGAAATTCCTCGAGTATGGATCCCTGGAACAGCAGCAACTGCTTGTGGAGTTGATGACAAGCAACATGATCAG
TCTGGCGCTGCAAGTGTACGGGTGCCGCGTGATCCAGAGAGCTCTTGAGGTGACGCAAGTTGAAGAGCAACTTGAATTGATCCGACAGCTGAAGGGGCAC
GTGATGAAGTGCGTCGTGGACCAAAACGGCAATCATGTCTTGCAGAAGTGCATTGAGGCAGCTTCTTGGAAAAGAGCGGCTGAGTGCAACGGATTGGGAT
CTCGACGTTTTGTGACGGGGGAGGACATCCAATTCATCATCGACAGCTTCGTCGGTCACGCTGCAGCACTCTCTACGCATTCGTACGGATGCCGTGTGAT
TCAGCGCGTGCTGGAACACTGCGCGCCTGATCAAATCCGCCCGCTGCTGAGCGAGATCATTTTCAAGTGTCGTGAACTTGTGAAGGATCAGTTCGGCAAT
TACGTTGTACAGCACGTCATTAGCCACGGCGAGACGGATCAACGCAACATCGTAATGCAGGCGGTGCTCCCTGAGATAGCACGCTGGAGTCAACACAAGT
ACGCAAGCAACGTGGTGGAATCCTGCTTGGAGCACGCAACGAAGGAAGAGATCAGCCAGATCGTTGACTTCATCCTTCAGTGTGACGAGAGTGGAGCATC
TTGTGCGCTGCTCCCCATGATGAAACACATGTACGGCAACTACGTGGTGCAGAAACTGCTGGAACGCGCGAATGACCGCGACCGCCACCGCATTGTATGT
ATTATTCGACACAACGAAGACTATCTGAAGCGCTTCACGTTTGGGAAGCACGTTTTAAGCCGACTGGAGCGCGAGGAGCAAGTGAACAACTTCTACTGAT
CAGGCAGCTCTGGAGACCACTCCGCAGCACTAGCGGCTCTCAAGCAGGTGGGGCACCAGCCCAGCAGCCCTCAACACGCTCCTGCGCTTCCTGTCCGCCT
ACACAACTTATATAAATATTTTGCGGCGCAACGATCAGCGGATCGCCTTCCACGCGCTGATTTGAGTTCAAGACCAAGCTGCAGTGACAGCACTATGACC
AAGACCAAGGTTTGAGCGTACGATACATGGGCCACCATACCAAAACTAATAAAGAGGTTCAATCTATAGGTCCTTTTGAATGAAATGCACCCTTTTGCAT
TGAGAACTTTTCCCGCTCAACAATTTCATCCAATAAAATGTACACAAACGTTATATTACCGACCAATCAAAACGATTAATACCATGTACTTCAACTTAAA
TGTGCGTTTCTCCTTAGAGCTACTACAGCGCTTAGCGTAGGCTCAAAACCTACAGTTCCTGGAGCGCACGCGTCACTTGTACAGATGCACGCGTTCCGGT
GTCGATAGCAGCATGCACCGTCATGCCCGGCTGCTCGAAGGCGGTGGCCTCGCCCGCGAAGAAGATCCGACCATCGACGGGCTCGGCGAGATCACGGGAT
GCCGTGTCCGATTGGCCCACGCGCGGGAAGGCGTAACCTCCACGAATCCACTCGTTGTCTCCCCAGTCCTCGTACATTCCCTTCACGAAATACTTGCGCG
CCGGCGCCGGCTCATCCACGGTGCCATAGATCGTGTCGAGTTGGTCGAGGAAGCCTTCAATGATCTCTTCATGCGCCACGCCCACAAACCTTTCTGCGTA
CAGCGCACCAGCAAAGCCAGTGATCAGGTACTGCACGTTACCCCCTTCGGAGTCACAAGCTTCCTTCTCAGCGCACAGCATATCGCCGTTCGACTTCAGA
TATCCGATGCCCTTGGTATTGTTAAACCAGAACTCGGGCAAGAAGCACTCCGAGCAAACGACACCGTGCGCGTCCTCCGGCCAGAAGCGACCCGACATGT
GGAGCAGCACCTTGCCCGCGCGACGCATGTCAAACGACGCGACAGCGTCAACCTTCTCTTGCGGAAGCGCCGGGGTGTACGCAATCTTCGAGAACACAGC
AGTAGCCACTGTCACCACCAGTGTGCGGCACAAGAGTTGCTTACCAGACGTGCTGGTCACGAGAATGCGATCGCTCTGGGAGTAGTCCACACTCGCCACA
GGCCAGTTCAGACGCGTCGTCACACCCTCGGCAAAGAGCTCAGCAAAGCGCATGAAGCTCGGCACGACACGGAAGTCGCCCTCGTCCTCCAACTCAATCC
ACTGCTTCTCGTAACGGCACGTAATGCGCATCGAGATGTCTTCGAGCGGTCCACCAGCCGTGTTGGCATATCCTGACTCACACAACTTCATCATCGACGG
AGACAGACCAATCTCGTTGAAGTAGTCTCGCATGGATTTCTCGGGTGGGATTTGGTCAATGTTCTCAAGGTCGCTCAGGTCGGCCACCGACAAGTTAAAC
TTGAGGAACTCCTCGTCCTCATCATCGAACTTCAGCATGCGCTTCTGGTCACCGATGTAGTAGTAGCCGATGCCTCCATCGGGAGCAGGCTCGGTTGGAC
CACCATCGCCCTACATTCAAGCAGAAAATGTAATGACTGTAAGTATACCCGATCGGTGCAATAAATTGGCTGAACTAGTGCTACAAGTGCATATCAATTT
CGTGGTAATGGGATGTATGAATCCAGACTGACTTCTCGCGGGTGGACACGTACAAGACTCAACGACACAAGAACTGTGCCGTCGAATGCACGCAGAAGAG
CAAAGAGTCTCCCGGAGGAGACCGCATCGCTCGCCCTGGAGATGTTAATTAAGGAAGCATTCGCTCTTGCATTCGTATGAAGGCCAGAAGATCATTGGGC
TCTTGCGAGCTGAATCAGTGGCTGATTAATCGATGCGACTACACTCTACTGACATGTATTAGCATTCTGTTCTCCTCACCTGAGCCCAAGTGAAGATCTC
CCGCAGTCCGATGTGGTACTGCTCGGCGAGCCGAGTGAGCGTCGTGTTGGCGCCGTGCATGAACTCGGCGCCCACCTCGATGCTCATGCCCGGGATGAAC
GTCGTGTTGCTCATGACACGACCGCCGATGCGGTTTTGCGCGTCCACGACCAACACGTCCTTGACGCCCTTGACGTGCACCAACTGGCTGGCACAGCGCA
GCCCGGCGATGCCGGCGCCAATGACAACCACGTCGTGAAACTCCGGCTGCTCGTTCGCCATGCTACAAGTTGTCGACTGGGAAATCTAAAATGGCTCACG
AAGGGAGTCGCGCGGAGCTCATGTCGGTTGTACGGGAGACCACCAATCGAAGAGTATCTGCTGTGGCGGCGCTGCGGCATTTTTGTGTTGCCAGCATGAC
TGGTCAGCAGACTGTTCGGCAGAGGCGACTTGTGTTTTGTATGATCGGACCTCCCCATACCAAACGCAAGTTACCAGTCTTGTCGTCGGGTGTAGCAGAA
CTGTCTAGTGCACCCACATGCCAGACGAGAGTACTGCGGGAGACAGAATAGTTTGATATGTTGCGCGAAGGGATGCCCCGGTTCAACCTAAACGTTGGTA
GCGTGGCAAATGTACAACGAGTTTCGTTATTACCTCTGGAAGAAGCCGCTCCGCATAGCCGATTCGCAATGCAAGCGGCAATGTCCATCGTCCACGTGCA
CCGTCAACTGAGGCAGTGACAGCACAGCCTGGTTGAGGGCCACGTCATTCACCGACACATTGCCGTGCTGCGGAAGAGGCATACACGTGCATAAACCTGA
TCGATAGGGTGAAACTCAAATCACACCTCCAATACCTGCACTTGCAGTTACAATCAGCCATGACATCCGTCCTCGAGAACTGCTCCTGAGATCCCGGTCA
TTCTCCATTTCCTTCCTGTGCTCGCACGTGACATCACCTCGCCACTCTATCGCCATGTCTGAGATTAAGACCGAGTTCGAAGCCGCCGCCGCGCTCGTCA
AGACGTTCACCAAGAACCCCGTATGTGGCAACACCATCGGCAATTCTCACAACCAACCCCCTAACCAAGTTTGTGTCATCTCTCTTTGCAGTCTAACGAC
GAGAAACTCGCCCTGTACGCCAACTACAAGCAGGCCACTATCGGTGACAACACGACGTCCGCCCCGGGCATGTTCGACCTCACGGGGAAGGCCAAGTGGA
ACGCTTGGACCGCCAAGAAGGGCGTGTCCACGGAGGACGCCATGAAGGCCTACATCGCTGAGGTGGAGAAGCAGAAGGCCGTCTACGCCTGAAGCGCGAC
TGCCCGGTCGCGTCTCTAAGTTGTTTTCTTCCTCGGGTCTTCTGTCATTTTACTGCTGATTGCAGTGAACGGCAGCGATTTTCGTTCTAGCTCCGGCAGT
TTTGGGCGCGTGGACTGGTACATGGCGACGATCGACCTGGCACCTGCTTACACGTGAGTCGTTGACGTCTTCGCAAAATCCCCATAAAAATGTTAGCGGA
AGACGGTTTTGTATACTGCTCGTGCGCAACTTCGTTAAGCTTTCGTTCACCTATCTGCATTACTCTGCTAAATGTCGGGACGTGTAGGAGACGCCGCGTG
TGGCGTTGGTCGAGGATTCCGCTGCCTTGTGATGAAACGAGCTTGCCTTGACGTGAACGCCACTGAAATGTGTGTTCGTTGAGATACGGTCGTCAACGAC
ACTGACAACAATGAGCCTCTTGGCAGCGCTTAAGAAATGACAGCCCTGGGCACATACCCATGGCTATCACCGGAGACTTAGTGTTTTCATCATCGCTCCG
CTGCGTAGTTACAACCACTTCCGGCGGTGGGTGCAGCCCACAACAGCACTCAAAGAAGGACGTACCAGCTTTGAGTCTTGTTTGCCTCCTCATTTCGTCA
TGCTGTCCACCTTGGCCTCGACCTTTGCCTCCATTCGTGCGAAGTCGGACATGAGCTTGTTGATCTGGTCGGTGTGCTGCCCCAGCTTCGCCGTCAGCGA
AATCTGCTGCACCGCTAGTTGCTGCTGCGTCTCGGTGTTTTGTGTCAGCAGGCGCATGAGAAGCACCTCCATCTGCTCACCCGCTGCCGTCTTCCCCATG
GAAAGCTGCGTCATGGCCAACGAGCTATCTTCAGTTTGGTTCTCGTTGACGTCGTCGTTGTCCTTCGGTTTGGCCAACGAGACTTGAGTTGCGAACGATC
CGGATGCGACCGATGACATTGAAGATGTTGAAGCTGACGTCGCTGGAGACATCGGCACTCCGATTGTCTTCCTGCCAAAGCTTTGGAGCTCGTTTTGCAC
CGCAACGTGAACGATGTTGCTGACACCATCTACTTGATTGTCATCTTGGCGCCTCTCGAACTTCTCGGCAGCATTGTTATCCAGCTCGGCCTTCTGTTCG
TTTTCGGCCATCGCAGCGGTTGTTGCGATCTCTGGGAGGTTTTCGCCAGCAGCTAAGGCCAGTCGCTCCAGAATGGAGATATCGCACGCTTCACGGGGAC
GTGTGTCCAGGACGAAGACGCTTCCGACGGCGTGACCCGAGTTCGGGTCCAGGATAGGCGCAGCAGCGTAGAAGCGCACGCCGGCAGCACCCGAGACGAG
CGGGTTTCTTCGGAATCGAGGGTCCTGAAGCGTGTCCAGTACGACCATCGGCTCGCGACTGAACACCGTGTAGGCGCAAAAGGCAATTTTGCGCGGGATC
ATCTTGTGTGCCAGACCCACGCTAGCCTTGAACCATTGTCGGTGCTCATCCAAGAAGCTCACCGCAGCCATGGCGCAGGACAAACGCGCCTTGGCCAAGT
CGCAGATCATGTCGAAGGGTTTTTCCGATTCGGAGTCCAGCACACCAAGCGCGTACAAGGCTCGAAGTCGGGCTTCTTCATCGATGCTCACTGGTGGTCG
AGGCCATGGGTGAGCCCACTGAGATGATAGTTCGTTGCTGTCCTGCTCGACCTGCAGATTTATTTGGTGAGTTTTTCTGGTCTCGCCTTCCGCGTTGAAG
TGACTATCGTCAAGCTCAAAGTGTTGGCGTGGTTTGGGTGTGAGTGAGAGGAGTTGGAGTTCTTCACTGTCCGGCTCGGATGAGGGACCGGATGCCGGCG
AGTGCAAGTGGCTCCGAAGCCACTGGCGAGACACTTCTGAGGTCGCACTGAAATGTGGCGACGGAGCCCCGGGTGAACGTCCGTCATGCTGGTGAGAGTG
GTTGATCACGCAGGACATGCACACTCGAACGCGCGTGGGGCCGATTGTTGAATCCAAGTGAGCCTCTTTGTGGAGTGTGCAGTTCTTGCAGACAACCTCA
CCGCACTGCCAACCAAAACGGAAAAGCATAGCAAACAAGCGTCAGGGATCCCGAAGGGAGCTTCAAACTGCAACGGTCTTACCATGCGGCAGTGGTGTTT
GCGACGGAAGGTCCCAAAGGGCCTCGTACAGACGTAGCACAGGGTGCGTTCGTGGTCGGCGACCCAGTCGGCTGAGTCCACGAGGTGCAGCACGAAGAAG
TCGTCGGCCGCCATGTTCGTCCGATCAAACTCGAGCAAGACTCGCGCTAGCTCTGCGTCGCAGAGGGGCTATGTATCACCGCGCCGGGAAAAGGACTAAT
GGCACCGCTAGTGCCCGGGCAATGTGGCGACCGCGGGCAATGGAACGAAACGCCCTCCATCTCGCCCGCGTTGTCTATTTAATGTTTCTTCTGGAGGGCC
CGGAAGGAGTCGGTGGCGACGCAAACTGCAGAAAGTCAAGCGGAAAGCGTTCCAGCGGCGCAACAGCGACGGCGTTTTCTGGCATGTGGCGGTTGCTAAA
TTTCGATTTCAGCGCGGCCCAACGCTAGCGAACCTCATTTTTTGCGTGGCAGCGCTCGCCGCCGAACGCCCAGGGCTTCCCATTTGGGCGGGGCCCGTGC
GAAAACCCGTGGAGCCGGAAGAGGGAGGCGTCAAGTGTGCACGCGTCGTACGATCCGCTTGAACCCAGCCCGGAGCGTTGCTCGAAAACAAAAAGGGTCG
TGCGCAGACGGAAAAGTTCCTCTGCGTTGAAGCATGCATCTACTTCCCATTTCCTGACGGAGCTCGTGGCGAACAAGCTGTGAATGTGACGACCACATGC
GAGCGACCCGGAATGTCGAGCTGGTACTTGTACAACAAGTTGATTTTCACTGTGTTCTTGCCGTCATCGTTTGGGTTTACGCTGTGCATGAGTCAGGTGA
AGAGCCCAGTTCAGCGCTCCAGGTTGCACACATCGTCACTTGCCGGCGAGCAGCGCCGATGAGTGGACAAGCCCATGCTGGTATTACACTGCGTCAAGCC
TGGGTCGGCGCCGCCGCGTAACGCCCGCATGGTCGTCAGCGCTTCCCATAATACCGATCTTCTGTGGACAGCGCTTTGCCCAACACGTTTCGTTAAGTGG
ACTGCGTCCAACTCGACCACTGCACACTCGACGGTGATGACCCCGAGCGTCGACGCCTGCTACATTGGACTCTGGCAGCTCTCACGACCACAGCATCAGT
AACATTTGCAGAGCTTAATATCTACGACTGGTTGCACAACTGCCAGGAATTCTGCCGCAAGTCCCAGCTCTTCATCCACCGGTAGATGCATTTGTTTGCT
TCGTTTTGACACGAAAGCGCAACCGCAAACATGTTGGTCATGCCTCGCTTCAACGTCAACTACACGACCAAAAACGATAAATTACACCATAGCCACCCCA
GATCCCCCTTTTCATAAACCATCAAGACTGACGTCAAGCATGCGACTTTTTGCGGCGCGGAACCTGGCGCGCTTGACCAGCCGACAGAGCCCCAAGGTAG
GAAGCGCTCTACCCCTGTCTACTTTCCTCTCTTCTTCAACCAATTCTTCCCCATTAATTTTGCGAGCGTACACGCTGTAGAATCTTCCATTCGCAACACT
GACTTTTCTTGCTTGCAGTATCGTGGCTCGACGCTGCGCCAGGCGCTGCTGCTGAGCGGCTTGGGGCTGTCGGTGCTGGCCTTGGCCAACGCGGACGTGA
GCGGAGCGCACTTGGAGGCGCAATGCGACGCCAGATACGCCCCGCCCGAAGTGGACGGCGCCTTCTCCGTGCCGCTCGAGCGCGAGGAATTCGCGTCCAT
CGCCAAGTCGCGCGCCACGCGCCTCAGCAGCGCGTCGTACAAGGCCAACTTCCCCATTGAGGACAAGTACGCGGTCGAGGCGACGGACTCGGGCGACGTG
TTTGCGGCTGTGCTGGATGGCCACGGTACAGCATCAGTTCTTGGAGCCTTTCTGTGCATGTTTCGGAGCTCTCTAATCGTGCTTCGGTGGCAACTGGCAG
GTGGCTGGCAGGTGTCGGAGTACGCCAGGAAGACGCTAATCGGCAACGTGCAGAAGGAGCTGTCGTACCTGTACAAGTCGGGGACGAACGAGCCCGCTCA
TGGAGACGAGAAGACCGTCCCAGACGGTCGCGTAGCTGCTGCTATCCAGCGTGCATTTGGACGTACGGACCGCGACCTTCTGGCTGAGGTGGCGTCGGCG
TTCAAGTTGGGTTTCGGAGCTGTGGCACGCTGCGGTTCGTGCGCGTGCCTTGCGTACGTGCACGAAGGCACCGTTCACGTTGCTAACGCTGGTGACATCC
GCGCCGTGCTGGGGAAACTGGGCAAGGATGCAGACACTATTGTGGCGGAACCCCTCAGCAGCGACCAGAACGCGATGGTGAAGTTTGAACAGGAGAAGTT
GACCAAGGAGCACCCGGGGGAGGCGAACGTGTTCACGTGTCGCCACCCGGATTCATGTTACGTGAAGGGCGCCCTGCAGCCCACCCGTGCGTTTGGTGAC
TTCTCGCTCAAGCACCCAGAGTTCAACGGCCCGCCCTACGTGAACGGCGATCGCTCTGCTGGACGTCACTTCTCAGCTCCTTACACGCCACCGTACATCA
CGGCCACCCCCGAGGTCAAGTCACACAAACTCGAGGAGGGAGACAAATTCCTCATCATCGGCTCTGATGGACTGTGGGATTACTTGAGCAACGAGGAGGC
TGTGGAAGTGGTGAAGGGCCAAGCCTCGTGCGGAAACCACGACCTCGCTGGTCGTGCGCTGGTCGAGCGAGTGCTTCAAAAGGCAGCGAAGCGCTATGGT
ATGACGTACCAGGAGCTGCTGAGCTTGCCCCCAGGAAGCCACCGTCGCCGTCGTCACGATGACACGACGGTGGTTGTCCTCTTCTTCGACTAGAGTGAAT
TGAGGCTGTGTCTTGCCAAGCAGCCTTATGTACAGCTAGCTACACGGAGGAAAATGCAAAATACGCGAGCATCCAAAAGCTCAAGAATCAAAGTGAAGGG
TTTGCCCCTCTTTACGATGGTTTCTAACTCGAATTGTGTGCGTTGCGAGGAGATATAACAGTATTTCTACTGGTAGTTTGCGGCGGGCTCGTTGCGACTG
AGAGAGGGGCCGTCGAGACGCTAGATAATGCAGTGTTGACGTTCCTTTCCTTGTCTAGCTGCTGCCTATACATGTCGTAGTTCTTCTCCAGTGTGTCGGT
GTAAAACTGCATGAATGTCAATACTAGAGTTAGGAAGTGGTGATAAGCTACACAAAAGAACACATCGAACATACCCGAAGGTGATGGCAAAGTGACGTCA
GCGGAAGCCAAATGGGGCGCACGACGTAGTTGATGAAGTTGAGCTGCACGATGATCCGAACGCGCTTATTCTCCAAGTGTTGCATGAAAAAGTCGGTGGG
CACACCGTGCTCGGCTTCAACCCCTGCTTGATTCTGGAATTCGTCGAGCAACCGAGCCCCCCACTCTTGTGTCTGTGCAAATGGCAGAGCGTAGTGCGAT
AGATCAGCAGCATGCATGAGGATGCCCATGAAAACTGGGCGTTTGTCGTTGAGTTGTCGGCGTGTAAGACCCTCGAGAACCTTGCACTTCTCAAAATGCT
TGGACATGTCGGTCGCTAGGATACAGGCGATGATCAGTTGGCGCACGCGTTTGCTGCGATCACGGTCCAAATGCTGCAAGATCTTGGCTGACTTGTGATT
GAGGATAATAAAGGTTACGCGGCAATGGTGGCGCTCCAACACAGCGTCGTCATTGTGTGTGAGCGCCATGGGACTCAGCATTTTGAGCTCGAAGTCGTTG
GTGTTGCCTGGATGGTCGATATCGTGGCAAAGCGAGGCGACAAGCATGGCAAAAATCTCGAGACCACTAAAGTACCGTCGGCATTCGGTGCGTAGGATAA
TATGCATGGCAACCATCACTTGGAAGGCGTGCTGGAAGTTGTGGAACGGGTTGCTGCGATAATAGTTGGCCACATTCGTTGTGAAGGCCGAAAACTTCTC
GCTGGAAATGCGGAAGGCGTCCATAAACCCGTAGGCGCGGAAAATGATGCCGCAGCTCATTGATACTTCACTGCTGGAAAGCGACATTGTTTCGGTATCC
CAGTGATCCAGTGGTTCATCTTTCCCATGAGCGAAGAAGATTTCTCGTGGGAATGGTACTTCGTCGTCCTCTTGGTTCTTCTTCTTAATGGCGGGAAGCA
GCGCTGCAAAGGACGGTATACCCTTCTTCTTAGTGACGCTGGTGTTATCGTCACCGGAATGACAGTACTTGTGTACGATTGAGGATATGATATCCGTCTC
GGAGAATTTATCGATGCGACTCGTGGTTGACATTCGCTTCAACGCCCGGGAGCTTGAGTCTATGCTACTCGTTCGTGCGACAGCTACGCAGTCTGACACA
ACCTTGTAATACGAGATATCGAGAGACAACCGCCCCAGCGCAAACTGCACCTCTGCGCAGTATTTGCTCATGATTTCACGATCCGTTTTGGTGAATGCTA
CGACGTGGGCGCCTTCTTTTTTGTTGATGCACATTGCCACGGCAACCACTTTTGGAGGAGTTGTAACCGAGTGATCCTCGAATATTGGCATGCAAAGTAC
GCTTGTAGTGCGGTATCCTGTCTTCATGTCAACGCTCGGGTCAAAAAGTTCGTGCTTGTAGGCATCACGGGTACAAACCGTTTGGCCGGTGGTTGCTACA
AGCCCCGAAATCCCGCGGTTAATAGGAGATCGAATGCTCTCACCACCCACACGCGGAGTAATCCAGAGTTCATGCTTAAAGTGGTCGATAAGAAGCATCC
CGAAGCGATCGCACTCCATGATGTCCTTCCCCAGTTCCATAACCATGTCCACAAACTCAGCAATGTCGGTACTCTCAGAGATAAACGTGGTGAGTTTAAG
CCGCGCCTCTATCAACTTCTGCGACGTCCTGACCTCGCGATGCAATGACGCTTTGTGGAGGGAGGTACCCACGGCCTCAGCTGCATAATTGAGGAATACT
GCATCCTCGCTGGTGAAGTCCATTCCGTCCACCTTATTGACTGCAGAGAGCACTGCAAGGATCGTTCCTTCAGGAGACTTGACGGGCAGACACAAAATGC
GCTTGGTGAGGAAGCCTGTCTTCTGATCCAGTGTCGAGTCGAACAGCGGATGGGAGTAAGCGTCATTCGTGATGACCATCTCACCAGTTCTCGCGACGTA
CCCGGCAATACCTTTGGTGATCGGCACATACTCGCCTCGTACGATATCAGAAGCGCTAGCGATGTACAATTCGTCCTCACCTTCAATCTTAATGAACAAA
CCGATGCGTTCGGTGCCCACGAGTTCGTGGCAAACTGCGAGCACTTGGTCCAGGACGGCAGACGATGAAACACTCTCCATGGATATGTTGCGGTGTAGTT
TTAGTAGACCTTCAATTCGGTGCTGGGCAGTTTGTCGCTGACGCGAAAGCACTAGGTTCCAAATGGTGGCACCAGCTGCAACTGCAATGAACTCCAAATT
CGAGATATCTGTATCGGTGAAGGATGGCGGAGTCACCATAGGCTTGTCAGTTGATGTCGACGAAGGATTTCCCGTAGTGATGGCTTGCAGTACTCCAACA
ACTGCATGATGAGCATTGCGAATCGGTAGGCAAAGCAAGGCTTGAGGAGTACCTACACCACCATTGTTGTCCGCCTTGTTTCGCTGGGTTTGGAAAATTG
CGTGTGTGTCGAGGTCGTTGATAGCAAATGGCCGACCTGTCATGATGACGCGACCGAAAACAGTGGGGGAGTCAGGCACAACGAAGCCTTCATTGATGAC
ATTGACCTTCACGAACGACAAGTCAACGTCAGCATCAGCGGGATTGCGGGAAATGGAGCAGATGTCTAGGACATTCCGGCGTTCGTGAAGAATACCCAAC
GTGAATTTGTCTGCTCGAACCAGTTGCTGCGCAGCTCGCAGCGTGCGCTCGATGACGCTTTCAAAGCTGTTCTGCGCAGAAACCTCCTTGGCCAGAGCCA
TCAGCGCCTCCAGCTGCGAAACGCGCTTTTGCATCGCCACGACACCGCCTGAAGCCTGCTCAGATGACCCTGCAGCAACCGGAGACATCTCTGTCTGTGA
TCCGACAAGGCCTTTTGGCCCCATCTTGGGGAAGACGCCATTGCCGCCATGTCCGATGGTGCTTTGCCGATGCTCCAACAGTCTCGATTCCACAGTTGTT
GACCTGCTTCGCAGCAACTGCACCCGCTTGCGGGTTTCCTCAAGCCTAGCGAGTAATCGTCGCTTCTCCGATTGCTGCTCGCGAACGCCACTCAAGACCG
CTTTAAGAGCGTCGGCTGGCACGAACACCTTCTTGTCGCCCTCCGTGGAGGTCAT