Description :
From Genome Similarity Track
Location :
Scaffold_996:683- 4202
Sequence
3519 bases(100 bases per row)
AGCTACTCCGACTCGGCTGTAGACTCGGAAGACGATTACATCGACACCGGGTTCACCAGCGACCGCGACCGTAGATCGGGGGACCGAGGGAACTCAGCTG
GGACACCACGGAGTGATCACCGAAGGGGTCAGCCGAGCTCGGCTGACCGCGCCAGTCGAGGATACGATCGGCGTGACCAGACTGGGCGGCGCAGTGACTC
CCGTGAACGCCCTTCGTATGGACCTTGTGCTGCCTGCGGTGGTGCAAACCACTCCGTTCACTACTGCCGCCGTCGCTGCAAGTTCTGCAAGTAATTGCAC
GATGTCGGTCAATGCGAGCTGTTCCAGCGCTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGCTACCGCTACCCTAGCGCCTGAGGAATTAGCATTGAGCGCGGAGCCTACTGCTGACTTGGTCAATGGCCCGCCTAGTCGAGCAGAGATCACAGT
GACGGCTGGTCAAGAAGCGCCCAGCCAAAACGCCTGTGCAGCAGATGAGTGTGAAAGTGAGCAATCCAGCGATTTGTCTGACTGGACGATCATCAACGAC
CCCGGGCCCAAGCCGCCGAGTCCAAGGCTCGAAGATGAGGTCGATGTGAGCGACGAGCCCATGTCGTCAGACCCGGAGGAAGACCTGCGCTTACGTTACC
TTCTGGCAGCCAAGTACGAGGACGAGACAGATGGTCGAGGCGACTCGGCGGGAGACTCAGCCGAGTTCGAGCACCAAGCAACGAACTTGGAGCTCGAAGG
CTATGCTCGCGAGTTGGCGTTCCTGCCCGATCTGACTGAAGCGGTGTCGACGCCACTCGACTATGAAGCGCCAAACGTTCGGAGCTCGGCGCACACTCGG
CCACAGTCTACTCGGCTGGTGGAAGTATTGAAGAACCATGAAAAGATCATGATCTCCAGTCGTAATGCCCTACCTCCACCAGCATACGGCGTAGTGTGTG
GCATCGACGTACAGGGGCATCCGGCAATCCGCCAACGAGCCCGCCGAGTTCCGCTGAAGCATCTCGGCAAGTTGTACGAGCTGCTCAAGGCGCTGTTACG
GGCTCGGCTAATTGCCTTCTCGAACAGCCTATGGGCATCACCCATCGTGATTGTCCTAAAGAAGAATGGGGTCGACATTCAGTTGTGTATCGACTACAAG
CTGGTAAACGCGCTTACGTTGCTCATGGAGTATGCCATGCCGCTAGTGGACGATCTCCTCACGGAGCTGGAAGCGTACCTATGGTTCTGCTCTTTGGATG
CTGCTAGCGGTTTCTGGGCGGTCATGATGACTCGACGGGCGCGTTGGATCTCGGCTTTTGTTTGCGTGATAGGCCACTTCGAGTGGCTGCGGATGCCCTT
CGGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN