Description :
From Genome Similarity Track
Location :
Scaffold_2221:683- 3277
Sequence
2594 bases(100 bases per row)
TCTGGAATCAGTAGGGTATCCAATGGTGTAGCGCTCTCAAGGCCGGTAAACAGCTCAATTGGAGACCTATTTCCCAGGGAGGCAACGGGAGAGTTGTTTA
AGTTGTGTTGGACCACAGGGAGTAGATACTCCCAGTTTCTCATGTCCAGCTTTGACTCTATCAACAACATCCTCATTACTTGAAGTATGTCATGGTTGAG
ACGTTCGACGGTACCATTTATCCACGGGGAGTACACTGGAGCGAAACGTTGAACAGCACCCATCTGATCCCTTAACCGCTCAATCACTTGATTTTTGAAG
TGGGTCCCATTGTTGGACATCCAGATTTTTGGAAGACCGAACCGTTTAGCCCAATCTAACACAGCTGCAGCGGTAACGTCGCTTGACGCAGAGTCACAAG
GAATGAGCTCGCAGAAGTGTGTCAGTTTGTCTTTCAGAACGAGAACATACTTTGTAGCGCCATATGTTTCCCCCATGAAGAGGAAATCCATATGAAGAAC
TTCGTTTCGCTGGGGGACCACTTGAGATTCATCCCAAGGTCGTTGGATCAGTTTTCCACCCTTAACGTGCTTGCACAAAAGACAGGACCGTATGAACCCT
TCCACGATCTTTGCCACGTTGTCAATGGAGTAATTGCGCTGGAGTTGGTTGATCATTACTTGCTCTCCTCGGTGCGATTGTATCCCGCAGTGGGCCACAA
TCAAAGTACGTTGGAGTAACTCTTTTGCCTGACTTGGAATCCAAAGTTTGCCATCGACACAGAGAGCACCATCCATTTTCTCCACTGCTCCTTCGATGCT
GCCCATAAAACGTCGTTGCTCACGTAATACTTCATCGCGCGATGGCCAAACAAACTGCTCGCTTTGCAACGGACGTAGCACTGAGACCCCCTTGTTATTG
TTCGATGTTAAACGCTTCAAATTCCCCACAGCAGTTTGGTTTTGGCTTGGGCTCCACCTTGACACAATGTCCGCCCATAAGTTATCGCTTCCGCTAATAT
GCTCGATGTCGTAACGGTAGCCGGTCAATCGCATTGCCCATCTCTGAAGTTTCTCCCTTACATGTTGTTTCAGTTCTTGACTTGGGCAGAATATCTTGAT
CAAATTGGCATGGTCACAAAAAATCTTGAATCCCTTTTGGTGTTGAAGCAGATATTCCAAGTCTGTGCATGCCTTCACAATCGGGTACGCCTTTTTTTCA
ACAATAGACCAATTAAGCTGCACTCCCTTGAAAGATCCACTCTTGCAAATCAAAAGCTCATGCGCTTGTTTGTGCACTGGTGCCTCCATTTCCCACACTT
TTACTTGTGTCACAACCACTGCCCACCCCAAATTGGAGGCATCAGTGGCCAAGCATACTGTAGCTGAAGAGTCTGGAAACGCCAGCTTGGATGCACTTGA
CAGGAGAGAAATCAGCTCATTATAGGTGGTAGTCGAGTCAGCAGCCCACGGCACTAAAATGCCTTCTGCATGCCGCTTCTTTCGGCTCCTGTTCATCAAA
ACGGTGTCCAATAGGGGCTACAACGCGCGCGTAGTCTACCAAAGAGTCTTGGATCCAGTTCGTGGCACAAAGTAAATGCTGTAAATTCGCTGCGGTCACA
GGTACTGGAAGCTGTTGGAGTGCCAAAATCCGTGCTGGATCGTGATGAACACCATCGCCATCGATAATTTTCCCACATCACTTAATCTCCCGTTGAAAAA
GGGAACTCTTCGTTGCACTTAGCTTGAGGTTGTAGTCACGAAGTATCTTGAAGAATTCTTCCAATTTCTCCAAATACATGGCATCGTCATGTGCGAAAAG
TGCGATGTCGTCGATCCAGATCAAGACCGAGTCATACAGCATCCCACAAAATACCTCCTGCATTTGAGATTGGAAGTGAAGGGCTGAATCAACAGCACCC
TGGAGGACTCGAGTCGGGGTATAGACGCCGTCCTCCGTGACAAAACTGAAGAACTCTTGACTGTCTTCGTGAAGAGGCATCTGCCAGAAGCCTTTGAACA
AATCGAAATTGCCGAAACACCGAGCTCCTTTTACCTTACTTGTCACCAAATTCAAATTAGGGGTCGTTCCAGCGATGGGAATGGTCATTCGGTTTACTGG
TCTGTAGTCATTTGTGATCCGAAAGTCGTTCTGGCTTCCGTTTTTCCTCACTGGTACCGCCGCACAACACCATTTGCTGTAGTTGTTCTTCGTGACAAAT
CCGTAGGCTTCTAGTTTTTTACGTAGGTCTTCAAAAACAAGCTTTGAAGCTCAGGATACTTTCTCACCTTGCACCGAAATGGCAGACTCCCTTCCCGTAG
TGTCACTCTCAATGGCGCCACTTTGGCAGGGGCGTCTGGTCCGATGCGTACTCTCCACGCATCGCGGTATTGACGGAATAAATCACGGAGCTGGGGCATC
CGAATTGGCTGAAATCCATTCGTTTCTGCTTCACCAAGCATCCTCTCAAAACATGCTTGCACTTCATCTTCAACAACTTGACCAATACTCTCTTCGACGG
GTATATCATCGCCTGCATCCGAACCAACGGACAAGCTTGCCGACTGTTCAATCATTTGGTTTACGTCGATCCCCATGACCTTCAGCGTATTGTT