Description :
From Genome Similarity Track
Location :
Scaffold_1040:683- 2929
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1040-fgenesh-gene-0.0Transmembrane protein

Sequence
2246 bases(100 bases per row)
CGACGCCGCTGCGACGTCCAACTCGATCTGTAAGAGCGCGGCGTTCCAGGCGCTTCCGCCCACGCAACTCGGTCTCTCGCCCGTGCTCGTGCGCTCGTAC
GTCTCGGGCACGGAAGTGTGCTTCGAGTTCCAGCTCTCGCCGTCCGTGGGCACGGCCGCGTGGTTTGCCGTCGGTCCTGCGTCGACCTCGTCCATGGTCA
ACTCGCCCGTGAGCAACATCATGCTTTTCCAGTCCTCCGTGGGCAAGCCCGAGTCGTTCACGCTCGGCGGCTACGCGACCAGCGCCGTGAAGAAGGAAGA
TGACCAGTCGTTCTTTGTGCTCCACGAGACCTCGACGTCGCCGCTCAAGTTTAGCTACCAGCGCACGCTCGCCGCGTCGTCCCCCAGCGACGTGGCGCTC
GACGCCACGGGCGTCAACGACTTTATCTGGGCCTACGGCACGGCGTGGCCCATCTCGGGCCACAAGAGTGGCACCAAGGGTTCGGCCAAGTACACGCTCA
CGTCGGCCGCGAACGCGCCCGCTGCGGGCGCCAACGGCACTGTGCCAGTGATCTCGATCCAGCCCGCGAAGACGGAGTTCTGTGACGACAACAACTGCCC
CGCCGTCGTGGGCGGCGCGGCCTTTGTGGCCATGCTCGTTGGCGGCTTTTTCCTCACGTCCACGATCCCGTACTCGCCCCTGGGCCGCGCGCTGCTCCAG
CGCACGCTCACGAGCCCGCCGGTCAAGCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGGCCGTCACGTCGCCCGGTGTCATGTTCCTCC
AGAGTCTGGCCGACTTGCGGCTCGGCGAAGTGCTCGTCGTGCTCATCTTTGCCGCCGCCATGGCCGTGCTCGTGATCCTCAACAACAAGAGCAAGGTCCA
GAAGACGTCGGGCCACGCGGCGCTGCTCATCCTCATGTTTATGATTCTGCCCGTGACGCGTATCCCGCTCTGGAAGATCTCGTTCGGCAGCTCGTTTGAG
CGCATCGTCAAGTTCCACCGCTGGCTCGGTATGGCGCTCGCGATCGCGACCTTTGTCCACTTGCTCGAGGGCACCAAGGTGACCAAGATCACGAACACGG
ACAAGCACGGCACGGTCACGCCCATCTACGGCTTTATCGCCTTCTGCTCATTCATTCTCATTGGCCTCACGGCCAACGAGTACATGCGCCGCATGTTCTT
TGAGGTCTTCTACGTCTCGCACCGCGTGCTGTCGATCGTGGGCTTTGTCTTTACGATCCTCCACAACTCGAAGACCATTGGCATGGCGCTCGTCGTGCCG
CTTGTGCTGTACGTGGTGGGTGTGGTTCACTCGTGGATCATCTCGTACTCGACGACGTACGAGGCTACGGTCACGGTCCACGACGCCACGGGCGTGGCTA
CGCTCTTGCTCACGTCGACGGAAAAGACCAAGCGCTTTGCGCAGACCATGGACCTGTGCTCGTACTTCTACATTCGCGTGCCGTCCGTCTCGGGCTTCCA
GTGGCACCCGTTCTCGGCCATTGTCACGCCCAGCGGCGACTCGATCGGCTTCTGCATTCGAGGCATGGGCCCGCCGGGCAAGCACACGTTCACGCGCGAG
CTCATTGAGCAGGCGCGCATGAGCCACACGTTTGCGATCAACCTGTGCGGCCCGCTCGGCAAGGTCTCGCTCGACGTCGACAAGTACGACGTCATTGTGC
TCATTGGTGGTGGCATTGGCGTGACTCCGCTGCTCAGCGCTGTGAACCAGCGCCGCCTCTTTTCCAAGAAGTCGGCCAAGGCCGTCGACTGGAACATTCT
GTGGTCGGTGCGCGCGCCGGAGGACCTGCTCATGATCGACCAGCTCATGCCCACGCAGGCGCAGCTCCAGTACGCGGCGGGCAATGCCCTCCAGGAGCCG
TACCAGATTGGTGGCGGCGCGCCGGCGCTCAATGCGACCTGGAACGCGCACTGCTCGAACGAAAAGAACGACGGCGTCGTGACGCGCCCCAACGGCGAGA
CGATGGCGTACCGCGCCGGCATCCCCGTGCTCGACGAGTACATCAACACGGGTCGTTACATGGGCCGCAAGGTCGCCGTGCTCGCGTGTGGCCCGCCCAC
GATGGTCGTCGAGGCGCAGGCGCTCGCGCGCAACTGTGGCTTTGACTTCCACAAGGAGATCTTCCACTGGTAAATTGTTCCCATGATCCCATTCCCCAAT
TCCATATAAATGCATTTTTACACAAATTGGACACCGAAGAATAGAA