Description :
From Genome Similarity Track
Location :
Scaffold_3540:683- 2124
Sequence
1441 bases(100 bases per row)
CACAACAGAACTCAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGGGAGTTGTCGTTTCCCGGCGATGACCCGGAGGGTTGGCTCGCCGGAGACTTCC
CCCTCTCTTTTTCGGGTGAGAGAGGGAAAAAAGGGCCCCTCCGAGGCTTTAGTGGCTATTGTCTCAACACACACACACCGCCGCAAGTTCGGCGCCGCCT
TCTCCGCCAAACCAGAAAACTCCGCCTTCTTCCTTCTTCCAGCATAGCTGAAGTTCCCATCGACTCGGAACGCTCGCAGAGCTTGCGCTAACCGCGCCTC
CAACCAGTCGCGCCGACCTGAAGTTGTGCTCGCATCATGCCACATCCACCGCCTCTTCAAAAGAGTTAGGGTGTACACGGAACACTTCCGTTCGAGCTGC
GCTCACACGAAGTCCCTCCATGAACACGGTCACGCTGATCAGTTCCGGAAGAGGGTCCGCCGCCATTCCGGCGATAAGAGTTCTCAACTCTTGGACATAG
TTCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTTTGACCGGATACGGTACGCCTGATTAGGCGGCGCGAACACGCGCGAAAGCTGTTGCTTTC
AGCTGATCCCAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCCATTCGCGAGCGCGACCTCCAAGCCTGGAGACAGCCAGCGCCACGCG
CTGATGCTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAAGTTTTTACG
CTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCCGTTGCGGCGCTCATCTTCTCTTGGACATGCTCCAAGAGCGCGT
TCTCGTAGCGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGATGCAAGATGAGCCACGCCCTCCCGGGCCAAGCAAGGACATAAGCT
TATTAAGCGCGTCCTGCTGCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCAGAGGATATAGTCAACCGACTCAGGAGCGGGATTGACTA
CAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACA
CTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGG
GTAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCAGCCAACGTACTGAGAGACCTTGTTAACTCTCCAA
CTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTA