Description :
From Genome Similarity Track
Location :
Scaffold_74:68296- 70956
Sequence
2660 bases(100 bases per row)
GAGTCCCCCCCACCTTAACCAAGAGTCACACTCTAATAGGGTGGGCAGACGCGGATGGCGTAAGCCATTCACGAAGAACGGTGTGTGCTGGGTTGACGCA
CCGAATTATCGATGGCGAATTGCACCATGGGAAGGAATTCGCTCCAACTCGAGAACGAGTGGACGTATCCTCGAAGTATCTCTTCGAGGACACGGTTTGC
ATGTTCCGTCAACCCATCTGTTTCGGGATGGTCAGATGTCGACATGTTCAATCGCGTTCCGAGCGACCGGAACACGGATTGCCAAAACTCCGCCGTGAAT
CGAGGGTCACGGTCGGATACGAGTTCACAGGGTAACCCGTGTAGTCGGAAGATTGTGTCGATGAAGACACGAGCACATCCCTGTGCCGTGATTGACTCGG
GTACAGCAGCAAGATGCACCATCTTGATGAACCATTCCACGAACACAAGAATACCATTATTCTTGTGAGCGTCTTCAGGGAAACCGAAGACGAAGTCCAG
GGAAACGGACTACCAGCACTCTGCCGGGACAGGTAGAGGATGTAAGGGTGCACGGGATGAACGACTAGGATTCACCTGTTGACAGACCTCGCAAGCACGA
ATGTACTTGCGTACAAACTGATACTGGCGGGGTCAGTAAAAGTCACGACTTACCTTAAGGTAAGTCTTTTCGCTACCACGATGACCACCTGTACGGGCAT
CGTGACACTCATACATGATCCGCAAGCGCAAATCGTTATGAGCGGGGACGACGACACGAGGCGTGTCGCCGGCAACGGCTGTATAGTACAGCAACCCGTT
GCGTGCTGTGTACCGATCTGATGAGGAACGGTACAAAGCCGATAAATCTTTCAACGATTTACGAGTTGGATTCACAAGATGATCCATCAAGTGCAGAAGA
TTCTTATCTTCTGCGTAGGCCTTTCTTACGTCATCAAGTAACGTTGACGACGGGACACTGACTGTAAGTGTCGCAACAGTGGGTTCTCCTCATTGTTGGA
TTGCGCGCCCGGCTCGAAATCGGGTCGCCACGAAAGCGCATCAGCGACGACATTCAGGCGTCTTGGTTTGTACTTGACGGAGAAGTTGTACTCCGCGAAA
AAGGACAGCCACCTCGGCATTCTTTGCGAGAGGTGTGGACTGTTTACGGCCGTGCGTAGTGACGCATGGTCCGTATAGACGATGAACGGTCTATCTCCTA
AGAGATAGACACGAAACTTAGCCAGTGCGTATTTCATGGCAAGCAGTTCCTTGTCATGCACTGGACAATTACGCTCAGCTTCTTCCAGCTGACGCGATTG
ATAGCAGATGACGCGCTCTGCGCCATATGTATCAAAATGCATCAACGCACAGCGTTTGCAAAATCGCTGGCGTCACAGACCACGTGGAATGGTCTGTCAT
GATCTGCAATCGCCAGTATGGGCGATTGCATCAAGCTCTGCTCGATACGTTCAAAGGAACGCTGGCAGTCAGCGTTCCATGACCACTTCACAATGTTCTT
GAGTAAACAAGAAAGATGCAGTCATCTCAGCGTAGTTGCACGAGTACTCGTGCAAGTACGCCGCTTGCCCAAGGATAGTCCCTTTACATCGACTGGCACA
GGCCAATCGGTGATCGCCTTGATCTTTTCGGGATCAGGGCGTACGCCGTGTTTACCCACGGTGCACCCAAGAATTGGTATTTCGCTAGCCGCGAATATAC
AATTCTTGAGGTTGGCATACAACTTATGCTTCCGCATAAGTTGAAAAACCTGACGAACGTGTGTTCTGTGAACTTCCACGTCCATCTTCCCATCCATATC
CCGGCTATGGACGAACTCATCGTCAAAGTGACTCGGTGCAAAGTCCCGCACCGGTCTCAAAAGATTTGTTACACATCTGTTGAACGTTGCAGGGGAGTTA
CTCAGCCCCTGTGGCATCACTAGCCACTCCCACAGCATACCGCTGGGGGTGCTCACTGCTGTGTACGGGATGTCCCGTTCACGCATTAGGATCTGATAGA
AGCTATCAATAAGATCCATAGACGAAAAGATGGTACTTTTTGGCATTTCATATATGATTACGTCCTTCATCGGTATCGGCGTCTGAGCCGGTACCGTTGC
AGCATTCAACTTGCTGAATGCGTGCACTATCCGCCACCCTCCTGTGGCCTTTCGCACACAGAAGGTCAGAGAGCTGTGAGGGGAAGTTGATTCCCTCACA
TGGTCCGCTGCAAAGCGCTCGGCAAAGAACTTGTCGATCGCTAGTACTTGTTCACGAGGCAGTGGCCACTGCTTCATGACACAGTACTTCGAGCCCAGTT
TGGGCTAGATATCGTGTCGAGTGCTTTTGTCCTTAGGCAACTCGCATGGCACGAATTCAGGGAACACATCCTTGAATTCGATCAAATCCTTATACAAAGA
ATTTGCCTGAAGCGACTCCCAAGATTGAGACGTGTATCGTTCAATCCGAGTCTTCTCATCAAGGGCACTTTCGTCCATCGATGAGCTGTTGAGAACCCGT
TCGTTCTCAGCAAATACTGTTGCCGACCGAATATCGGTCACATACTCATCCTCTGTGAAGAGTATTCATATCTGCTTGACCTTTCCACTACGCAGATTAC
GCAGGAACCGTTCGGTTCCAGCGTTGGCAATTGAGTTATCTCCGAAGTTAACTTCGAAGG