Description :
From Genome Similarity Track
Location :
Scaffold_102:6826- 8939
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_102-abinit-gene-0.9Transmembrane protein

Sequence
2113 bases(100 bases per row)
CGAGTGCTTTGGCGGTCGACGGTCAGCAAAAGAGCAGTTGGGACCCATTGGTACGGATAGACAACTCGAATGAGAACGCAGCGACGATGGCTGGGAGTAC
GCGCACTGAGGCACAAACTGACCCGTGGTGGGAGGTCGACTTGGGTGATATGACACCAATTGCTCGCATTGAGCTTTTCCCGTTCGTGGGCCAGAGTGGT
GGTCGTGGGTACTGCGGTTCCTCTTCCGATGCCTTGTTGAAGGCGCCAAGTTGGGCGAGCGACCTCTTGTCGTTCAGCAAAATGGACCCACTGCTCCAAC
AGGAGGACCCGTTTCAGCAAACGTTTCAAGTTGCCCTTTCTGATACATCACTGACCAGCGGCATTGCGACTGCCACCAAGACACTGTCGTTCTCCTGTGC
CGGAGGTGTCGTCTCGATAGCATGGACCGATGTGTTTGCCAAAGCCCGCTTCGTGACGGTCAAGCGTCCGGGTGCGAATGTTCGACTAATGCTGAATGAA
GTCGTTGTGACGCGTTGGAACCCAGCGACGACGCCACAGTTCTTGCTCGTGGACTTGCGTGGGAAGGGTGACGCCCCGCTCGCACTTTCTAGTATTCAAC
TGTTCGCCCCGACGGACGGCGCCATGGCCTCTTCACTTGCAGTTCCGATCGCGTATTCAATTCACAGTGTTAGTTCTCAGCGGGCTACGGTCGGTTCCGG
ATCGGCGTCGGCACTAACAAGTGTCACGACGTCAGACTGTTACATCGCCGCTCAGGCGTCGTACCGCGAATGGATCGTTCTCAAGCTGACTTACCCCGTG
CGACTTGGACTGATCGACGTGCAGGCGAACATTGACACGTGCGGAAGCGGCGTGGCGTCAGTGTTTGCGGTGTCCGTGTCGGCGCGCGGTCTGACCCTTG
ACGGTCTCAGATCCGCAAAAGCAGAAGCAGCGTTGGCTACTCCCACATCCACGGGGTGCTCATTAACGGCACTGGGGACGCTCTCGACATCGTCTTCCTC
CGCCGCGTGTGAGACGTACACATGCGACGACGCAGCATGCCGGTCGTCTCGTCGAACATCTACCGCCGATGCTCTCGTGTTTAGTGACTTCAACGACATC
GTGATGTTTGGTGTGCCGTCATTGGTGCCGACGACGAGGCTGCCGCTCTCACAACATGAGACGCGCTCGATGCTCCTACGCGACAACCCCGTCATGCTCT
GGTCCTTCGATACGACGGAACCGCGCGCCGCCATCTCTGCCACGCGTACCGCAAGCTTGATTGAATTGAGCTCACCGTCTGCGAACAAGGTACTGGAGAT
TGACGATGACCTCGAGCAAACGTTCTTCTCGAATGCGGTCGCTGTGCAGCCTGCGATGAGCGCGTTTACCGTCGAGATTTGGATCCGCTTCACGAGTGCA
GCACCTGCCTTTGCAACGCTTGTGACTCTAGCGACGCAAACCAAGGCTGTGATTGCCGACATCCAGTGGAATACGCAGGCGCCAAAGGGTGTGTTCACTG
TACGAGATCCTCGTTCGGGTGGACTCTGCGCCACGAAACTACCACCAACTAGTCAAGTGTTTGACTCGGTCGGCCGATGGTACCATGTCGTAGCGTCGTA
CGATCCGAGCAATGCGCGGATGTCGCTCTCGGTTCGCTACAAAACAGCGGGGTCGTTGCTGCAAGACGTCGTGACACTGGCCTCTAGTAATGCGACCTGC
AGTCTTCCTCTGCTGAGTGCCCGCCACAAAATCATACAGATCGGCGCCTTCTCTACTTCCAGCACGGGGATTGTGGGCCACGCTGCAAGTGTTGCGTGGT
ACGTCGATGTGCTCACGGATCGCCAACTGCTGGATCATTTCTACGACTTTTTCTACCGTGGCACCTTTGGACCACGCCATAATTCGTACGCACTCCGTCT
AGCATCCAAGCCATCGACGCTAGTGACCGTGGATGTGAATGCCGAGACTGCGTGCTACACGGTTGGGCTGTGTAATGTCACGGCGCTGCCTCGGGTCGTG
TATTTTACACCCGAGAACTGGAACGTGCCACAAAATATTTTCGTCTTGGCAACTGACGATCAGCTCTACGAAGGTTTGCACCACACGAGTGTTGGTCACA
CCGTGTCGAGTCT