Description :
From Genome Similarity Track
Location :
Scaffold_54:68245- 69482
Transcript NameFunction/comments
Phyci_8622poly [ADP-ribose] polymerase, putative

Sequence
1237 bases(100 bases per row)
GCTCACTTACTTGGGGGCAGCCTCGGGGTCGAAGTACGGCACCTCCCCGTGCGGCGTCACGCGGACAGCGTGGCGGTTGCCAGGTAGGTAGTCGAAGGTG
GCGTAGTGGAACGTGGAGCGGTTGTCCCAAATCGCCACAGCGTTCTTCGTCCAGCGGAAGCGCACCTGGAACTCGTGACCCTCCGTCACGTGCTGGTACA
ATAGTCGCAGCACAGCGTCTGCGACAGTCGAATAGACGTGAACGAACAGTTAGCGAGCCGCGTTCACCTACCCCAAAACACTAACTCCTTACCAGACTCC
GCAGCAGACAACTGCACGATGCGCCTCGTGAACGCCGGGTTCACGTAAAGCGATCGGCGGCCCGTTACCGGGTGAGTGCGGACAACCGGGTGTTCAAACT
CGACCGGCGGGCGGCGGATCGTTTGGCCCTTCGCTGCAGCGGCAGCAGCTTGAGGCTGTCGACACACATGAACACGTTAAGACAACGATCCAAACACACC
CTCATCAACCAAACAGCAACTCCTTACGATGCCCGTGTGGATCGCCGTGAGACCTGAGATAAACTCCTTCATGGGGGGAGTGAGGCGGTCATACGCCTCG
TAGGCAGACGCCCACAGGGTGTCGCCGCCCACGGGCGGATTCGTCAGCACCTTGAAGCTCGTGTAGGACGGCGGCTGGCGCTCGTTGGACACGTCGCTGT
GCCAGGCGTTGAACGGATCGTAGATCTGGCGCTTGAGGAAGCCGTCGCTCGTCTCGACCGAGTTCTCCACGACCACCACCTCGTTGTGGCCCTTGGGGTG
GCCCAGGTTTTGGTGCACGTGCAGTGGCCCGTAGTAGCGTCCGAGCTCCAGCTGCTGCTCCATGTTGATCTCCTGGTCGCGGAAGAAGACCACACCGCGA
TGGGCAACGAGCAACGCCAGTTCGTCGCGCTGCACGTCGCTCAGCTCGTGCAGCTGGACGCCCGACAACTCGGTGCCGATCTTGGGCGCCAGGTGCGTCA
CCGTCGCGTCCTTGAGCAGGTTCTTGAACGTCGGGTCGGCGTGCAGCGCGCGGTCCTCGTACGGGAGCTCGGGGATCGGATCGAACGTGTCATCCGGGTA
CACGCTGAGCAGCTCCGGGTGCTCGAACTTGGCGTGCTCCACCTCCTGGTTCAAGGCGTTCTTGATGGCCACGGGCTCGGAGGTCTGGGCGCCCGACGTC
TTGGTCGGCTCGTTCTGGTGCTGTGGGGCCATTGTGG