Description :
From Genome Similarity Track
Location :
Scaffold_25:682398- 684071
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11900chitin synthase (Chitin-UDP-GlcNac-transferase)

Sequence
1673 bases(100 bases per row)
GTACCAACATCCATCACTGCGGTGTACTCCGGCTGGATCTGTTCCGCGAACGCATTGAAGTACCAGTGGTGCGAGTCCAGTTTGCTGGATTTGGTCTCCT
TTAGAGCGAATACCGTCTGAATTGGCAACAGACTCTTGCCATTCACATTGAGTTGCAGAGTGTGCTCGAACATGTGGCACTGGGCGCCAATACCGGCACT
GTTGATCGTCAAGAGGTCTTCGTCGTACAGTCCGATAGCTTCCAGGTAATCCAGCATCTTATCGTTAATCTGTTCGCGACCGTCTGCCACGATGCAGAGC
AGCACATTCTGCCACACGTCTTCGCCTGCGAAATCTCTGGACAGAGTCTTCTCGTGGTCTTTCTTCTGTTCTTTGAGATATGCCAAGTTATTGGCGAGTT
TCTTGAGTGTCGCCTTGAGTTGCTGTGGTCCTTCGTTGTACATTGTGATGCAGATCATGAGTCGCGGACGTCTGCCAGTCTCAACGCAACGCAGTCGATA
TCCTAGGTTGGAAAAGTCGATCGGGTGTGGGCAATACACTGGCGTGTACCACATGCGTCGAGCTTCTTCCTCGTCCAAGTAGGGCCCGACCCAGTCCTCA
TCCCAGTTACTGACTGGGATTCCGACCTTGTGTACTCCTGGTCGCGGATGTTTCTCCTTGATGCGTCCCTCAATCCAATCACAAAGTCTGGCACACCAGT
TGAGTGTCTCGAAGCCTTTGCTCGTGAGCAAGTTGCAGATCTTGGGGTTGGCTTGGCGTTCGGCCACATTGGCCATGGCATATCCACCTTCGAGGTAGAG
TTTGAGTGCATCTCGGTACCGTCTTGCACCGAGAGCAACTGCTGCGCGGTCAAGAGTAACCAGAGCTTCCTCGACGGATGGAATTTCGCTGTATGTGCGC
ACCAGATCCGTGGCACTGGCGTAGGATTTCATGCTCGAGATCAAGTCCTGTACGCTACCGGAGGGGAACGCTGCCCCCGTGGGGATGTAACTGGTGACAT
ATTGCTGTGATCCGCACGAACGGATGCTGGGGGGCGGCAACGGGATGCCATCGTACTCGACCGACATCATGGACGAGCGCGGACCTTGAGAGAGAGGGGG
TAAGCCCATGCTGCGGGGCTGGAAGCCGGAAGAAGGTGGCGGAGCGCCGCTCATTTCGGTACAATGTGGCTTGCGGAGTCGGCACCAAAATGAGAGATGA
ACGGGTTGCCACAAGCCGAGATGGCTGAGCAACTGGTGGATGTTGCCTCCCCGATAGGAGTTTTTTTGGCAGTGGCAGAGGCTTCGGTTTCCCCGGCTCC
ACCTTGTGATGGAGGCTATCTTACATAGGCACAGGTCATCTGGTTTATCTTGCGGCGCCAGTAACAAGTTGCTGTGGGGGAAACGGACGGCAAAAAGCGA
CGGATAGGATCAGTTGCGGGAGAGAGTGACGGCAACCAAAGCCTTGGTTGCAGAGCCTGCGTAGCTTGAGCGTCGCGGCAAGTTCATTGTGACTGTCACT
GGGGCTTTACCCGTCACTTCACTTGCAGGGGGCTACGATCCTCGACACTTCATTACGGGATGTAAATTTACGGCGAGGCAGAGAATCTATGCCTCGCAAC
TTGCAATTGGCTCAAATTGTCTCCAAGTTGAAGCGATGTGCGAAAACGGATTTGACGAATGGGTACAACCAAA