Description :
From Genome Similarity Track
Location :
Scaffold_758:6823- 10325
Transcript NameFunction/comments
Phymu_g11861hypothetical protein PHYSODRAFT_518156
Phymu_g11862hypothetical protein PHYSODRAFT_516884

Sequence
3502 bases(100 bases per row)
CTAGATCGTGCGTATTTTCAAGGTGGAAGAGATCGCAGAGCGTTCGAGAACTTATTCCTTGAAATTTGCTGTCATTCCGCTTCAGGAATGGCGCACTTAC
CGTGAAATGAGCagttgcagcgtcttcattgGTTCTGGCGATGTTTTCTGTTGCTCTAAGCGGCACTGAAGTCGACAGCAGAGGGGACGGTGGCAAGTAG
GAATTATCGGTGGCAACGAAGCCATGTCCTTCCCCACCCTCGTCGCTTAGCGCACTCAGCCGAAGCAACGGGTGATGATGGATCAGCACGGATTGTTCCG
TGCCGTTTAGCTCTTCACTTTGAGCTATCGTCACCAGTTTAAGCAATTGGGAGTAGTCAATTTTCATGTCTTGGATCTCAAACAGGAGTCTAGCGACGCT
GTTGAACCTGAAGCTAGACAGATGCAAGCCGCAAGCTCTCAGTACGCCTcgcatctcctccacgtcaATGGAACCCGAATGATCCGAGTCTCGTGCTTGT
AGTTCCGACTGCAGCTCACGTATAGATATTTTCTTTGCTTGCATATTTCCCCACAGTAAAACGGCAAAGTCAGAGCGTAGCTCTACAATTTCTCGGAAGT
GATTCACAACTTCACTCAGCGTGGCCCCATCTACACGGAAGATACTGCTCACCAGGACAAAGCTCCGGAATATCTGCGGCTGCAATAGGACCGTGTTCAG
GGCCAGCGGAATCGGAATCGCAAGTACTTCCAGAATCCCCAAGTCAGCGTAGACGACTCCGAGCTGGTACACCACACACTGCACTACTAATGCCAGGTAA
AACCCATTAAGCATCAGCAGCATCATCACAGTGAAATGCCATGATTTTCTTGAAAAATAGCGCATTTCGATCACAGGAGTCGCCTCCGAGGTGATAGCGT
ACTTGGGACGCTGGTCGACATTTGGTGACTCGTGCCACTCTTGCACCTTTTGCATGACTAGAAGAGCCTTTCCAGCGTCCTCCTGTGtccaagctcgagc
ttcttcgtacGCGACAGTTCTCAATTGCCTCGCTAAAGAGTTTTGATCCGTTGACATCCCAGCAGCCTCCAACAATTGATGAACGCACGAGCGGAAGTAA
ACGAACACAGCGATGTGCAGCAGAAGTAACGCCCAGGAGAACCCGATCAACACCAGGACAAGACCACGACGCATTGTTAGCGCTGGTTCGCCATAATTTA
TAGCTGTTGAGATTCTCTCCAGCACCCAGgccacgaccagcagcagtagccacATTGGCGCACTCACGTCAGTCATATGTGTGATCTGGTTGTTTTGTGC
CTGGCGCAGGTACTTGGCAAAAGGGAAGAGCTCAGGGAGCTCGAACCGCCTGAGGAATAAGTGACGCAACAAACGTAAGTGAACCAGCTCCTGAGTGCCT
TCCCCCCAGCCAAAAGCTGAGGAGGCCACAGTCTCGGCCAAGTCTCCAGTTGAAAGTAGCTCGGCTCGGTCTGCATGAACGTTGTGCTTTCGCAGCACGA
GGAAGATGCAAACGGCTTGCAGGATGAGGGCCAACGCCAGTATGAAGATGGTCAGATCTGCGACCTGGAAGGCCGTCATGGCAGCACTGCTACCATTGAC
ACTCGGCACTTCCTTGGCCAATTTTAACCCAAGACCGATAAGTCCGAGGATCATGAGCTCGCGATACGCCTTGCTCAGtagctgctggtacttggcggag
acggcggcgcGGTGTTCAAGGAGGTGAAGCGCGCGTTCAAAAAGCAGCAGACAGACCACCAGTACActcagatgcagcagcacacgcCATAGCTCCACGT
TGTCCCCTACACGAAAGAGTGACGTCCCTCCCATTGCTGTGCAGACGGATTTAGATCCAAGATTGAGATAATTTTTGGCACACAGAGCAAACTGGAAAAG
CTACAGATTCAAATGAAGGTTACTCGTTctggtacatgtaaatttacGTGCCTTGGAGAAGAGCTACAACACCTTACGACTCGTGTTCGGCCGTGTAGTT
GTAGTAGATCTTGTTCTCGTACTCCGGACCGCAGAAGGGGAACTCCGTGTCGGAATCCGTCGGGCTGAATAGACTCTTGCCCGTCGTGTAGGTTACGTAA
CAGCCAAGAACGAAGCACACCACGGTCACTACAACAGCAGCCGCCTTCTCGTAGATGGGGATGGTCCTCCACGCCTTCAAGAGGTAAAAGACGATCGGTA
GCAGGATGCAGTTCGTTGTGATGCACGAGGCGCCCACGAAGTCGGCGAAATCCGAAAAATGGTCTTGGAAAATAATGGACAGCACGACCAGGATAACAAT
GATGACGACACGCAGCGCAACGTACTTGAGGGTGGTCTTTCCACCACGGTACTCAGCCGCCTCAGCCTCCGGGTCATCCTTAAACTCCCGCTCGCTGTCA
GCCACCGACACGTAGGACATTTTGGAGCTTCGACGAGCTTCAGTCTGGGTGATAGCAGGCGTCGCGGATTCGGCGTAGCTAATACCAGCCTCCATGTCTG
ACGTTTCCCTCTTGTGCATACCCAATGCCAGGCGCTCTGCGATGTAGAACGCCGGGTTGATCAACACAGAGAACGCAATCGTGATGTGGAGTTGCATGAA
CAGGTaggccagcaccaccgcgcCCCAGCTCGGCTTGAAGCCCAACGTAGTCATTCCGGTGCTCGCGTCCGGATAGATTGTGAAAAGCAGGTTGCCCGAA
ATCTGGCAGCCCACGGCCGAATATGCTGTGCTGGCTAGGATCAGGAACAGGCACGAGATGAAACTCACAGTAACCAGAACCACGCGAGGCATACGCGAGG
GATCGCtgtgctggcgctgcaggtcTGGAATAACGATACCAGCACCATAGGCCAGTGCCAGGTTGCCAAAACATCCCAGCACCTGCGAGATTTTGAGGTC
AGGAGAAGGCACTGCAGGGTGACCGCGCATTCCGTGCATGACCACAGCCACACCGATGACATCTGCGATAATGGTGCCCATGCAACCAGCGAAGGCGGCA
CCGGCCCCTTCCTTGAGGGTCGGAATCAGGCACACGGGTAGCACCATGAGAGCCATCAGGATGATCCACACGGTAGCACTGAAGGCCTCCGGGAAGAGAC
CGTCAAGCAGCGAGCCACCGAGTACGAGGAAGACGCACGGGATGAGTAGACACGACCCCATCTGAGAGACGACACAGAGCCAACGACCCACCTGCCCCAT
ACTCCACTCGCCCAAATCTCCGAACGTCTTGACGGATTTCGGGGCTAGCAGTATGACTTGGGACATCTTGACGGACGCGTAGATATTGGCGAAGGCCATG
AATGCCATGGCAATGATGGCAATGACGGGCCCCGCACGTGAAAAGTTACCGGGCATACCCAGGGTGCCAATGCCGtacatgcagcagaagaggtTAAAGG
ACGTTTTCGCGTCCTCGACGGTGAAGAACGGCATCTTGGAGGGCACTGGAGACGACTTGACCAGAACGAGACCAAATGCAGAATGGCAGACGTGATTCCA
AA